Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.17329.1.S1_at Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.17329.1.S1_at
ATGGATTTTCATGGGCAATCTTCCAAATGCTTTCTTTGTTTAGAAAATAAAATCCACAAGCTTCCCTTTAGTAGCTCAACCTTAGTTAGTTCTAAGCCTT
TGCATTTTAAGGAATGCATTTCAAAAGGAAAGAGGCCAGTAGACCTTAGCAGGAAAGACCAGGGCACTTCGGTAATGTATGGAAGTACTAGACTGATGAT
GGACTTGGCCATTATGAGTTTCTCCAAGAAGCCCTTGACGGACTTGAGTTTGCGAGAGGTGCTCCGACTTCAAAATGTGATTGTGGAAAAAAGAATTATT
GTGATGAGGAGGAGGAGGAGGAGAGTCTTTCTCAAGCCAAAGAAGAAGAAGTTGCTTGTATTGAACCTGAATGGTTTTCTGCTCCACCGATCTATTCACA
CTTTCCGTTTCACAGATCAGGGATGCTGTCCTAATCCCATTCTAAAGTCTCGAACAGCTGATCAAATATATCTTAACTTTCTCCTTTTCAAGAGGCCATT
TAGTGAAGAATTTATGAAATTCTGCTTAGAAAGATTTGAAGTTGGGATTTGGACTTGTGCAAAGAAGATTAATGTTGACGGTGCTTTAACTTTTGCTATT
GGAGAAGAATCCAAAAATAAGCTGCTATTTGTTTGGGATCAAAGTGATTGTACCGATTCTCTTGCCATGTATTCAAAGGAGAATAAAGAGAAGCCTCTTT
TCTTCAAGGAGCTAAATAAAGTGTGGAATAAAGTCAAGAAAGGAGGTCCATATTCTGCTTCTAATACTTTGATGATTGATGACAAACCATACAAGCTTAA
TCCGCCAAATACAACAATTTTTGTCAAGTCATATGACATAGAGAACAGAGGACAATGCACTTGGTGGGCTGTCATTAGCGACGTGGTGCCCATGTGGCAA
GTGATGATTGGGCGAGGTGGTTTGCTTAAATAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.17329.1.S1_at:868:581GAACCTGAATGGTTTTCTGCTCCAC868581375Antisense
Mtr.17329.1.S1_at:772:231ACACTTTCCGTTTCACAGATCAGGG772231410Antisense
Mtr.17329.1.S1_at:496:971TGCTGTCCTAATCCCATTCTAAAGT496971436Antisense
Mtr.17329.1.S1_at:911:1039TAAAGTCTCGAACAGCTGATCAAAT9111039455Antisense
Mtr.17329.1.S1_at:966:1075TATATCTTAACTTTCTCCTTTTCAA9661075479Antisense
Mtr.17329.1.S1_at:964:723GTTGACGGTGCTTTAACTTTTGCTA964723586Antisense
Mtr.17329.1.S1_at:685:133AGTGATTGTACCGATTCTCTTGCCA685133655Antisense
Mtr.17329.1.S1_at:962:485GCCTCTTTTCTTCAAGGAGCTAAAT962485705Antisense
Mtr.17329.1.S1_at:492:121AGGAGGTCCATATTCTGCTTCTAAT492121753Antisense
Mtr.17329.1.S1_at:12:1041TACAAGCTTAATCCGCCAAATACAA121041802Antisense
Mtr.17329.1.S1_at:400:373CAATGCACTTGGTGGGCTGTCATTA400373865Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|995.m00014 /FEA=mRNA /DEF=Aldo/keto reductase; NLI interacting factor AC141107.5.141 78105 80280 mth2-34a12 01/13/05
Representative public ID: IMGAG|995.m00014
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
AC141107_52.4 (IPR001395: Aldo/keto reductase IPR004274: NLI interacting factor)
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
99.1.4.2817 SearchGO_ID:51843 ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC