Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.11488.1.S1_at Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.11488.1.S1_at
TTTTTGATAAGAATCATCCACTTGTTCTAAGGTTCATTAATGAATTTGCTTTGACTTTTGATGGAAATAAATGGGGGCATAATGGTCCTTACCTTGTTTC
TAGAGTTGTTGAAAGACTTAAGAAAAGACAAGGTTTCAATTTTACAATTTTGCCACCTATGGCCTTTTATCCGGTTAGTTGGACTAAGATAGGTGGTTTT
TTTAGGAAGCCTAAAACTAGAAGTGAAGAAAAATGGGTTGAAGCCAAATTGAAGCAACTTAGTGGTGAAACTTTTGGGGTTCATCTATGGAACAAACAAA
GTAGTGGATTGGTTATTGAAGAAGGAAGTGTCATGGCAAGACTTGTATCAAATCATTGTATCATTTGTAAGTTGTAATAGTTTTTTCTTACCTTATGTAT
AGGAACACTTGTGTGATGTAAAATCTAGCTTTACAAGTTGTGAAGAAATTCTCTTTTAACACATAGTTTGTCTACTTGATGATTCCAATTTAAGGATTTA
AATGATGGTGGTATCATTCCTTAAAAAATGATGGTTGCATCACGATCTTTTATATTATGGACAATTGGATCAAATGTAGACTGAATTACCAAGGTGACAT
CATCCTTAATAATATAGACAATTGTGATCG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.11488.1.S1_at:813:961TGAATTTGCTTTGACTTTTGATGGA81396153Antisense
Mtr.11488.1.S1_at:593:337AATGGTCCTTACCTTGTTTCTAGAG59333793Antisense
Mtr.11488.1.S1_at:901:237ACAATTTTGCCACCTATGGCCTTTT901237156Antisense
Mtr.11488.1.S1_at:593:367AATTGAAGCAACTTAGTGGTGAAAC593367259Antisense
Mtr.11488.1.S1_at:127:1053TACCTTATGTATAGGAACACTTGTG1271053401Antisense
Mtr.11488.1.S1_at:434:311AAGAAATTCTCTTTTAACACATAGT434311455Antisense
Mtr.11488.1.S1_at:27:1061TAGTTTGTCTACTTGATGATTCCAA271061476Antisense
Mtr.11488.1.S1_at:147:671GATGGTGGTATCATTCCTTAAAAAA147671516Antisense
Mtr.11488.1.S1_at:437:671GATGGTTGCATCACGATCTTTTATA437671542Antisense
Mtr.11488.1.S1_at:359:931TGTAGACTGAATTACCAAGGTGACA359931587Antisense
Mtr.11488.1.S1_at:881:835GGTGACATCATCCTTAATAATATAG881835605Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC110096 /FEA=mRNA /DEF=
Representative public ID: TC110096
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
TC110096; CT030165_30.5 (IPR001093: IMP dehydrogenase/GMP reductase IPR007577: Glycosyltransferase sugar-binding region containing DXD motif IPR007652: Alpha 1,4-glycosyltransferase conserved region)
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
1.7.14.1 SearchE2.4.1.228 lactosylceramide 4-alpha-galactosyltransferase [EC:2.4.1.228] ( Evidence )
1.7.8.10 SearchKDTA 3-deoxy-D-manno-octulosonic-acid transferase [EC:2.-.-.-] [COG:COG1519] [GO:0016740] [CAZy:GT30] ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC