Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.14175.1.S1_at Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.14175.1.S1_at
ATGGGATGTTTTTCTACAACTGATAGTCTTATTTACGCGTCTTTAGCTCATGTGAAGGTAAAGGATATTCTTGATCAATCCTCCAAGCTGATCTTGAATA
CTCCTTTACAACCTTTGGTTGATGAGGATAAGTTGATTTGGAAGACTGGAAAAGAATGGAAAGTACTCAGTGCAGTGTGCCTATAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.14175.1.S1_at:125:825GGGATGTTTTTCTACAACTGATAGT12582515Antisense
Mtr.14175.1.S1_at:1079:209ACTGATAGTCTTATTTACGCGTCTT107920931Antisense
Mtr.14175.1.S1_at:127:27ATTTACGCGTCTTTAGCTCATGTGA1272743Antisense
Mtr.14175.1.S1_at:508:499GCGTCTTTAGCTCATGTGAAGGTAA50849949Antisense
Mtr.14175.1.S1_at:172:17ATTCTTGATCAATCCTCCAAGCTGA1721779Antisense
Mtr.14175.1.S1_at:395:695GATCAATCCTCCAAGCTGATCTTGA39569585Antisense
Mtr.14175.1.S1_at:205:183AGCTGATCTTGAATACTCCTTTACA20518398Antisense
Mtr.14175.1.S1_at:444:415CTTGAATACTCCTTTACAACCTTTG444415105Antisense
Mtr.14175.1.S1_at:160:379CAACCTTTGGTTGATGAGGATAAGT160379121Antisense
Mtr.14175.1.S1_at:1104:601GAAAGTACTCAGTGCAGTGTGCCTA1104601171Antisense
Mtr.14175.1.S1_at:516:139AGTACTCAGTGCAGTGTGCCTATAG516139174Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|1001.m00010 /FEA=mRNA /DEF=LQGC hypothetical protein AC141114.14.91 28449 28685 mth2-8g20 01/13/05
Representative public ID: IMGAG|1001.m00010
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset (database reported 'No record found.')
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
99.2 SearchUnclassified without homolog ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC