Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.13269.1.S1_at Predicted as a legume specific gene  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.13269.1.S1_at
CTGCACTGTATAGTTTCAAACATTGCTTTAATTTTGATAATTATTTTCATGAATATAATGTCAGTATTGATTATGCCCTTTTGAGTAGTACTATGAAACT
TTATCAATTTCATACATGACTTAGTTAGGGGGCAAATATTAATAGAAATCTAATGTTTATTAGATTTCTCTCAAAGATAGGTTGTTTATTGAAGGAACAA
TCTGTTCTGTTGTATTAGTTGTTCTTCAAACACCCTTTCACATTTGAAATTTTTTTAAATTTAGGTTATTATCTTTACATATCTCTGTTGTAATCTGCTG
CTGAAAGGCATAAATTTCACTTTATATAAATCAATTGTGAAATGTGTGTCATCCACTTTGTTTGTTATTTCACAGATTACAATCTATATCAGATTTAATT
TTTTTTTTCTTGTTGTAACATATGCCTTCGAATAATTAAACAGCTATACAGTAGTATAGATGTTGTTTAGTTCAGACAGAGGCAAATATCAAATATTAAA
TATCTGAGTAAATTTTGAGAGTAGGGAACTAATTTTATTCTGTTCCATACCTAGTTATATTCGGATATACATTTTTAATTTTGTTTGTGAAAATCATTTA
GCTGTTTTTTATGACATTGTACGATAAATGATTTTTAGTTGTTATGTATTTGTGAAATCAGATGAATTTATTTGATATTTGATTTGTTTGTTGTGAAATG
GCTTTGTTTTGCAGCCTCCACCAAACAGCTGAAGATCTCTTGTTA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.13269.1.S1_at:370:731GTTCTGTTGTATTAGTTGTTCTTCA370731216Antisense
Mtr.13269.1.S1_at:738:937TGTTCTTCAAACACCCTTTCACATT738937232Antisense
Mtr.13269.1.S1_at:1105:123AGGTTATTATCTTTACATATCTCTG1105123275Antisense
Mtr.13269.1.S1_at:223:37ATATCTCTGTTGTAATCTGCTGCTG22337291Antisense
Mtr.13269.1.S1_at:771:797GTGAAATGTGTGTCATCCACTTTGT771797349Antisense
Mtr.13269.1.S1_at:77:777GTCATCCACTTTGTTTGTTATTTCA77777360Antisense
Mtr.13269.1.S1_at:760:417CTTGTTGTAACATATGCCTTCGAAT760417421Antisense
Mtr.13269.1.S1_at:820:719GTTGTTTAGTTCAGACAGAGGCAAA820719474Antisense
Mtr.13269.1.S1_at:875:361AATTTTATTCTGTTCCATACCTAGT875361543Antisense
Mtr.13269.1.S1_at:500:727GTTCCATACCTAGTTATATTCGGAT500727554Antisense
Mtr.13269.1.S1_at:937:185AGCCTCCACCAAACAGCTGAAGATC937185725Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC97491 /FEA=mRNA /DEF=
Representative public ID: TC97491
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
TC97491; AC156827_15.5 (hypothetical protein)
Legume specific gene
Based on BLAST searches, this transcript is predicted as legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
99.2 SearchUnclassified without homolog ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC