Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.27838.1.S1_at Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.27838.1.S1_at
ACATGGGTCCAATCCATTGTTATTCTCTTGGACAATCACCAACTCTTCCTTGGGGCCCAGAAAACAGCCACATGGGATGACTCTGTGGATCGCCTCGCCA
TCTCTTTTGACGGAGAACCCATCACCCTCCACGAATCTGAAGGTGCGAAATGGGAATCATCCGGCGTGTCCTTTGGTAGGGAAACTTCAACAAACAACAT
TATTGCTGAAGTTGAAGGAAATTGTAAGATAACTGCTAAGGGTGTCCCAATAACCGAAGAACACTCGAGGGTTCATAATTATGGTATCACCAAAGATGAT
TGTTGTGCTCATCTTGATTTAGCGGTTCAAATTCTCGTCTTTGAGCAATGAAGTAAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.27838.1.S1_at:492:595GAAAACAGCCACATGGGATGACTCT49259572Antisense
Mtr.27838.1.S1_at:444:103ATGGGATGACTCTGTGGATCGCCTC44410384Antisense
Mtr.27838.1.S1_at:454:439CTCGCCATCTCTTTTGACGGAGAAC454439106Antisense
Mtr.27838.1.S1_at:1027:197ACCCTCCACGAATCTGAAGGTGCGA1027197136Antisense
Mtr.27838.1.S1_at:493:249AAATGGGAATCATCCGGCGTGTCCT493249160Antisense
Mtr.27838.1.S1_at:521:1013TCATCCGGCGTGTCCTTTGGTAGGG5211013169Antisense
Mtr.27838.1.S1_at:878:313AAGATAACTGCTAAGGGTGTCCCAA878313238Antisense
Mtr.27838.1.S1_at:755:941TGCTAAGGGTGTCCCAATAACCGAA755941246Antisense
Mtr.27838.1.S1_at:477:229ACACTCGAGGGTTCATAATTATGGT477229273Antisense
Mtr.27838.1.S1_at:1046:719GTTGTGCTCATCTTGATTTAGCGGT1046719314Antisense
Mtr.27838.1.S1_at:7:1113TTAGCGGTTCAAATTCTCGTCTTTG71113331Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
"BF004325 /FEA=mRNA /DEF=weakly similar to UP|Q9LT74 (Q9LT74) Similarity to late embryogenesis abundant protein, partial (9%)"
Representative public ID: BF004325
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
BF004325 (weakly similar to UP|Q9LT74 (Q9LT74) Similarity to late embryogenesis abundant protein, partial (9%))
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
99.1.4.2776 SearchGO_ID:13399 ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC