MtGEA & MtTI:
Home / Introduction
Search by... Analysis: Search / Analysis History: Whole Dataset:
Subscribe to Our Mailing List
and be updated with our project progress, new data release
and new functions provided at our database server (low email traffic):
External Links:- Mt Gene Expression Atlas Data at ArrayExpress
- Mt Gene Expression Atlas Data at PLEXdb
- Mt probeset-gene mapping
- MedicCyc, Mt biological pathways
- KEGG annotation of Affymetrix Medicago chip
- Center for Medicago Genomics Research of the Noble Foundation
- The Medicago truncatula Handbook
- Medicago.org
- Download flash player (required for visualizing gene expression profiles)
Transcript Details
| Mtr.27950.1.S1_at |  |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Expression profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Cannot see the expression profile chart below? Get flash player.) Customize slides (experiments)
 View co-expressed transcripts |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Consensus, target, and probe sequences: (
 How to interprete
) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>Mtr.27950.1.S1_at TGAAGGTTTATCACAGAGCGTAAAGCACTGGCACACGCTTTAAGCGACACTAAAACAGCTGTAAAACAATTAAACAAGCTTGTTACAGGGGTCCTAGTAG TGGTGACCATAATAGTGTGGCTTCTTCTAATGGAGATTGCGACAACAAAAGTACTTGTATTCCTCTCATCGCAGCTAGTACTCGCGGCTTTCATGTTTGG AAACACGTGCAAGAATATTTTTGAAGCCATCATCTTCGTGTTTGTAATGCATCCGTTCGATGTTGGCGATCGGTGTGTTATAGATGGTGTTGAGCTATTG GTTGAAGAGATGAATATATTGACAACAGTATTCTTGAAGCTTAATAATGAAAAGTTGTATTATCCAAACT Chip and genome coordinates:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Initial annotation during chip design | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| "BF521388 /FEA=mRNA /DEF=similar to GB|AAL77649.1|18700073|AY075640 AT5g12080/MXC9_3 {Arabidopsis thaliana;} , partial (16%)" Representative public ID: BF521388 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Gene mapping & annotations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Probe-based mapping to MTGI v8 and IMGAG v2 genes (
Strategy
) BF521388 (similar to GB|AAL77649.1|18700073|AY075640 AT5g12080/MXC9_3 {Arabidopsis thaliana;} , partial (16%)); CT967305_23.4 (IPR001093: IMP dehydrogenase/GMP reductase IPR006685: MscS Mechanosensitive ion channel IPR010920: Like-Sm ribonucleoprotein-related, core) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Legume specific gene | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Based on BLAST searches, this transcript is not legume specific. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| GO annotations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GO:0008381  (mechanically-gated ion channel activity); GO:0006811 (ion transport); GO:0016021 (integral to membrane) Evidence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| KEGG annotations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
KEGG annotations are based on the GeneBins database
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Biological pathways | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Based on the MedicCyc database , this transcript is not involved in a known biological pathway for the time being. |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcription factor prediction and categorization | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| No information available (not predicted as a transcription factor) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© Noble Research Institute, LLC