Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.7395.1.S1_at Predicted as a legume specific gene  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.7395.1.S1_at
GAAACCACGAAGAGGCAACACTACTCAACGGTTTTGATGGCCATAAACATGGTGTAAGGAGTCTGAATGCAGTTGTTGATTGGCTGCGCAATGCGGTTAT
CTAGTATATGGTTCTTTGAATATGATTTGGAATAGGGGAATGTCTCCCTCTTCCCTACCAATGTTCTAAAATAGAACCTGATTCTTCCCTCACACTTAGA
TGTTAATGATGTTCTAAAATAGTACCTTGAAAAGGGAATTATTTTGTTAATTTCTTTCTTCATAAATATGTACCAAGATTGTTCCACTCAATATCTATGA
AGAGAAAAAACACAAAATTTCAC

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.7395.1.S1_at:805:665GAGGCAACACTACTCAACGGTTTTG80566524Antisense
Mtr.7395.1.S1_at:312:1045TACTCAACGGTTTTGATGGCCATAA312104534Antisense
Mtr.7395.1.S1_at:788:225ACATGGTGTAAGGAGTCTGAATGCA78822559Antisense
Mtr.7395.1.S1_at:280:399CAGTTGTTGATTGGCTGCGCAATGC28039982Antisense
Mtr.7395.1.S1_at:251:441CTGCGCAATGCGGTTATCTAGTATA25144196Antisense
Mtr.7395.1.S1_at:958:501GCGGTTATCTAGTATATGGTTCTTT958501105Antisense
Mtr.7395.1.S1_at:334:435CTCTTCCCTACCAATGTTCTAAAAT334435160Antisense
Mtr.7395.1.S1_at:1136:241AAATAGAACCTGATTCTTCCCTCAC1136241181Antisense
Mtr.7395.1.S1_at:941:985TCCCTCACACTTAGATGTTAATGAT941985198Antisense
Mtr.7395.1.S1_at:788:33ATATGTACCAAGATTGTTCCACTCA78833278Antisense
Mtr.7395.1.S1_at:1125:715GATTGTTCCACTCAATATCTATGAA1125715289Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC111305 /FEA=mRNA /DEF=
Representative public ID: TC111305
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
TC111305; AC146560_18.5 (IPR001093: IMP dehydrogenase/GMP reductase IPR011545: DEAD/DEAH box helicase, N-terminal IPR001650: Helicase, C-terminal IPR000629: ATP-dependent helicase, DEAD-box IPR001410: DEAD/DEAH box helicase)
Legume specific gene
Based on BLAST searches, this transcript is predicted as legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
99.2 SearchUnclassified without homolog ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC