Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.14998.1.S1_at Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.14998.1.S1_at
ATGTCCAACAGTTACAAATCTGTTACATGTGATATTGAACACTTTACTTCCTGCTTCTTTTCATGTCCTACGTTAACATCTCTTGACCTTTTTGTTGGCC
ATAAGAATTTTAATGAGACAACATTATTTCCAAATTCTTTGAATTTTCCAGCATTAACGAGCTTATCTCTAACGAACTTTGCCTTTCATGTTGGGGATAA
TGGCTGTGCTGACCCTTTTTCAGAATTTAAGAATTTGAATAGTTTGATCATTGATCGTTGTGTTGCTCTTGATGCGGAAAACCTACACATATCAAGTGTC
ACACTTGCTAATTTAACAGTAAGAACACCTCGTGTTGTAGCTAGGAACTACCGCAAAATCGAGCTATCTACTGCAAGTCTTCGTTCTTTTGTTTTTATCG
GTATTCCTTATCAGAAACTCGTTTGGAGCCATCTTTGTTCAGTTACACATCTAAAAATTGATGCAAATGTTCTCTACTTAGTTCCTGATCTATTAAAGGT
TGACTTCCCTTACTTACGTAACTTGAAGTTACTGAAAGTAAAAATGGAAGGAATTCCATTTGATTTATCCAAGAAACTGATACATGCCAACTTAGCGAAG
CTTCCTGCCAGGTCACAAGAAGAAGCTTCCAAGTTACACGAAGCATTTAAAGTAGGGTCGAAATCATCTTCATCCATACCTGAGGGAATACTTGAATTTT
TGCTTCAAAACTCACCTTCAGCAAAAGTTTATATCATCAATTAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.14998.1.S1_at:169:293AACGAACTTTGCCTTTCATGTTGGG169293183Antisense
Mtr.14998.1.S1_at:649:51ATAATGGCTGTGCTGACCCTTTTTC64951209Antisense
Mtr.14998.1.S1_at:1115:691GATCATTGATCGTTGTGTTGCTCTT1115691258Antisense
Mtr.14998.1.S1_at:1090:723GTTGCTCTTGATGCGGAAAACCTAC1090723274Antisense
Mtr.14998.1.S1_at:249:589GAACACCTCGTGTTGTAGCTAGGAA249589335Antisense
Mtr.14998.1.S1_at:425:179AGCTATCTACTGCAAGTCTTCGTTC425179374Antisense
Mtr.14998.1.S1_at:432:1015TCAGAAACTCGTTTGGAGCCATCTT4321015423Antisense
Mtr.14998.1.S1_at:721:633GAGCCATCTTTGTTCAGTTACACAT721633438Antisense
Mtr.14998.1.S1_at:770:541GCAAATGTTCTCTACTTAGTTCCTG770541475Antisense
Mtr.14998.1.S1_at:1140:283AACTTAGCGAAGCTTCCTGCCAGGT1140283601Antisense
Mtr.14998.1.S1_at:400:1013TCATCTTCATCCATACCTGAGGGAA4001013676Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|723.m00031 /FEA=mRNA /DEF=hypothetical protein AC119417.17.311 107470 108537 mth1-6m23 01/13/05
Representative public ID: IMGAG|723.m00031
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset (database reported 'No record found.')
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
99.2 SearchUnclassified without homolog ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC