Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.27950.1.S1_at Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.27950.1.S1_at
TGAAGGTTTATCACAGAGCGTAAAGCACTGGCACACGCTTTAAGCGACACTAAAACAGCTGTAAAACAATTAAACAAGCTTGTTACAGGGGTCCTAGTAG
TGGTGACCATAATAGTGTGGCTTCTTCTAATGGAGATTGCGACAACAAAAGTACTTGTATTCCTCTCATCGCAGCTAGTACTCGCGGCTTTCATGTTTGG
AAACACGTGCAAGAATATTTTTGAAGCCATCATCTTCGTGTTTGTAATGCATCCGTTCGATGTTGGCGATCGGTGTGTTATAGATGGTGTTGAGCTATTG
GTTGAAGAGATGAATATATTGACAACAGTATTCTTGAAGCTTAATAATGAAAAGTTGTATTATCCAAACT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.27950.1.S1_at:187:849GGTTTATCACAGAGCGTAAAGCACT18784917Antisense
Mtr.27950.1.S1_at:48:307AAGCACTGGCACACGCTTTAAGCGA4830735Antisense
Mtr.27950.1.S1_at:445:809GGGTCCTAGTAGTGGTGACCATAAT445809101Antisense
Mtr.27950.1.S1_at:436:41ATAGTGTGGCTTCTTCTAATGGAGA43641124Antisense
Mtr.27950.1.S1_at:703:253AAAGTACTTGTATTCCTCTCATCGC703253160Antisense
Mtr.27950.1.S1_at:130:1013TCATCGCAGCTAGTACTCGCGGCTT1301013178Antisense
Mtr.27950.1.S1_at:485:1047TACTCGCGGCTTTCATGTTTGGAAA4851047191Antisense
Mtr.27950.1.S1_at:349:581GAAGCCATCATCTTCGTGTTTGTAA349581235Antisense
Mtr.27950.1.S1_at:467:453CGTGTTTGTAATGCATCCGTTCGAT467453249Antisense
Mtr.27950.1.S1_at:872:407CATCCGTTCGATGTTGGCGATCGGT872407262Antisense
Mtr.27950.1.S1_at:982:153AGATGGTGTTGAGCTATTGGTTGAA982153294Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
"BF521388 /FEA=mRNA /DEF=similar to GB|AAL77649.1|18700073|AY075640 AT5g12080/MXC9_3 {Arabidopsis thaliana;} , partial (16%)"
Representative public ID: BF521388
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
BF521388 (similar to GB|AAL77649.1|18700073|AY075640 AT5g12080/MXC9_3 {Arabidopsis thaliana;} , partial (16%)); CT967305_23.4 (IPR001093: IMP dehydrogenase/GMP reductase IPR006685: MscS Mechanosensitive ion channel IPR010920: Like-Sm ribonucleoprotein-related, core)
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
GO annotations
GO:0008381 Search Link  (mechanically-gated ion channel activity); GO:0006811 Search Link  (ion transport); GO:0016021 Search Link  (integral to membrane)
Evidence
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
99.1.4.3756 SearchGO_ID:49408 ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC