Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.35746.1.S1_at Predicted as a legume specific gene  Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.35746.1.S1_at
GGACAGCGGTTCACGCTTCTTCTTTCCAATTCACGTTTCTTCTTTCCTCCAGCCGAGAATCGCCGGAAACCCACACACCGTGGTTCACTCACTTCCTCCA
CCAAGCACCAGCTCGCTGAAATCGCTTCCTCCAGCAGCTCACTCTTCCTCTCGCCTCTTGTCATCAAATAAGGTAAGCTATGGATAATGAAGATGTTGGT
AGGACACGGCGTGGTAAGGAGGCATTGCATGCTTCTGTCCCCAAAGAGCAAGTTCCAAACGCTCCACCAAGGAGACGTGGACGTGGACGTGGTCGTGGGC
GTGGTCGGAGAGAGGAACTGGGTGGCTCTAGTTCCCAGTCTCAGATTGATATCGAGATGCCATCATCACAGTCAGCCTCTGGTTCACAGCCTCCTTCCGT
GGGAGTTGTTCAGGAGGGATACGATGGAGGACCTTCAAACATGTCTTTGTTGCCGAGTTTTGGCCAACATATTGCAGCAAAGATTTGGAATGGAGGTGTA
AGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.35746.1.S1_at:765:873GGACAGCGGTTCACGCTTCTTCTTT76587313Antisense
Mtr.35746.1.S1_at:1146:461CGCTTCTTCTTTCCAATTCACGTTT114646126Antisense
Mtr.35746.1.S1_at:443:373CAAGCACCAGCTCGCTGAAATCGCT443373114Antisense
Mtr.35746.1.S1_at:782:955TGAAATCGCTTCCTCCAGCAGCTCA782955129Antisense
Mtr.35746.1.S1_at:994:433CTCTTGTCATCAAATAAGGTAAGCT994433167Antisense
Mtr.35746.1.S1_at:977:665GAGGCATTGCATGCTTCTGTCCCCA977665231Antisense
Mtr.35746.1.S1_at:474:9ATTGCATGCTTCTGTCCCCAAAGAG4749236Antisense
Mtr.35746.1.S1_at:886:1131TTCTGTCCCCAAAGAGCAAGTTCCA8861131245Antisense
Mtr.35746.1.S1_at:47:641GAGCAAGTTCCAAACGCTCCACCAA47641258Antisense
Mtr.35746.1.S1_at:525:979TCCACCAAGGAGACGTGGACGTGGA525979275Antisense
Mtr.35746.1.S1_at:1061:665GAGGAACTGGGTGGCTCTAGTTCCC1061665324Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
"TC111931 /FEA=mRNA /DEF=UP|Q5YET5 (Q5YET5) Small nuclear ribonucleoprotein Sm-D1, partial (11%)"
Representative public ID: TC111931
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
TC111931 (UP|Q5YET5 (Q5YET5) Small nuclear ribonucleoprotein Sm-D1, partial (11%))
Legume specific gene
Based on BLAST searches, this transcript is predicted as legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
99.2 SearchUnclassified without homolog ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC