Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Sme.3022.1.S1_at Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Sme.3022.1.S1_at
ATGAGGTTTATCAACATTTTCACGCTCGTTCTCGTAATCGTAGGCGGACTGAACTGGGGGCTGGTCGGACTATTTAGCTTTGACCTCGTGGCCGCCATCT
TCGGGGTTGGCTCGGGGCTCGCCCGGATCGTTTACATCCTGGTAGGGCTATCGGCAGCCTGGCAGATCATCCCCCTGTTTTCTGTCATGGGCTCCGGCGA
GTTCGCTGCCGGCCAGAACCGATAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Sme.3022.1.S1_at:50:849GGTTTATCAACATTTTCACGCTCGT5084917Antisense
Sme.3022.1.S1_at:124:281AACATTTTCACGCTCGTTCTCGTAA12428125Antisense
Sme.3022.1.S1_at:1089:509GCTCGTTCTCGTAATCGTAGGCGGA108950936Antisense
Sme.3022.1.S1_at:910:433CTCGTAATCGTAGGCGGACTGAACT91043343Antisense
Sme.3022.1.S1_at:1066:895GGCTGGTCGGACTATTTAGCTTTGA106689571Antisense
Sme.3022.1.S1_at:625:1077TATTTAGCTTTGACCTCGTGGCCGC625107783Antisense
Sme.3022.1.S1_at:1034:491GCCCGGATCGTTTACATCCTGGTAG1034491133Antisense
Sme.3022.1.S1_at:682:1115TTACATCCTGGTAGGGCTATCGGCA6821115144Antisense
Sme.3022.1.S1_at:886:515GCTATCGGCAGCCTGGCAGATCATC886515159Antisense
Sme.3022.1.S1_at:555:471CCTGTTTTCTGTCATGGGCTCCGGC555471186Antisense
Sme.3022.1.S1_at:338:449CGGCGAGTTCGCTGCCGGCCAGAAC338449207Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
TIGR|NT01SMA0861 /FEA=mRNA /DEF=conserved hypothetical protein {Sinorhizobium meliloti 1021}
Representative public ID: TIGR|NT01SMA0861
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset (database reported 'No record found.')
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
GO annotations
GO:0008150 Search Link  (biological_process); GO:0003674 Search Link  (molecular_function); GO:0005575 Search Link  (cellular_component)
Evidence
KEGG annotations
KEGG annotations are based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC