Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.45035.1.S1_at Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.45035.1.S1_at
ATTTTCTTGTCTCCCGAACACGTTTGAGGGAGAAAGAAAGAAGGTTCACGGGAGTGTGCAATAGTTTAGGGCAAAAAAATCCAATTACACAACAAAACCA
ATAATTCAATTTTGATATAAAAATTCAAACTTTTGAAGATTTTTGGAATCTCACAACTGTCACCACTGTTTATCCATTTGCCCCAGCTAGATCTGATCCA
CAATTCATTCTACTTTTTCCTACCTCAAAAGGGTTTCTCATTCTTCAAATCGTTTTTCATCATCTGGGGGTTTTGAAGGAACTTGTTGAAGTTGAGATCT
TTAGCTGTAATGCAGCTTTGACTTGCTGCTTTTGATTTTTTGGGTTGGGTTGGGTTGTTTTAGCATAAAATTGAGGTGTTTCCACTTTTTCAAACTTACA
TAATGGTTTTCTGGGAAGGATATGTGAGTGATGAAGTGATGGGGACTTTTGCTCCTATTGTGGGTTTTATTGGATATATGCTGGATTTTATCACTTTGCT
TCCTTCTTTAGATAATTACCGGCTGCATACTACGAGAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.45035.1.S1_at:736:1009TCTTGTCTCCCGAACACGTTTGAGG736100917Antisense
Mtr.45035.1.S1_at:561:707GATTTTTGGAATCTCACAACTGTCA561707150Antisense
Mtr.45035.1.S1_at:985:377CAACTGTCACCACTGTTTATCCATT985377166Antisense
Mtr.45035.1.S1_at:767:935TGTTTATCCATTTGCCCCAGCTAGA767935179Antisense
Mtr.45035.1.S1_at:648:689GATCTGATCCACAATTCATTCTACT648689202Antisense
Mtr.45035.1.S1_at:381:1121TTCAAATCGTTTTTCATCATCTGGG3811121256Antisense
Mtr.45035.1.S1_at:49:147AGTTGAGATCTTTAGCTGTAATGCA49147302Antisense
Mtr.45035.1.S1_at:473:963TGCAGCTTTGACTTGCTGCTTTTGA473963323Antisense
Mtr.45035.1.S1_at:234:1143TTGCTCCTATTGTGGGTTTTATTGG2341143461Antisense
Mtr.45035.1.S1_at:72:1109TTATCACTTTGCTTCCTTCTTTAGA721109500Antisense
Mtr.45035.1.S1_at:15:363AATTACCGGCTGCATACTACGAGAG15363526Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC98645 /FEA=mRNA /DEF=
Representative public ID: TC98645
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
TC98645
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
99.2 SearchUnclassified without homolog ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC