Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.41575.1.S1_at Printer-friendly Version
Expression profile
(Cannot see the expression profile chart below? Get flash player.)

Customize slides (experiments)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.41575.1.S1_at
GGAATTTATAATTTTATTGCTGATCAATTTGAATGCTCATGTTTTCTTGAAAACGTGAGAGAGAATTCAGCTTCAAATCAATTGAAACATCTCCAGGAGG
AACTCCTTTTAAAAACACTAGCACTGAAAATTAAGTTAGGAGGTGTTAATGACGGAATTCCTCATATAAAGGAAAGGCTACATACAAAGAAGATTCTTTT
GATTCTAGATGATGTTGACAATTTGGAACAACTGCATGCTTTGGCTGGAGGACGTGATTGGTTCGGCTGTGGAAGCAAAGTTATCATTACCACTCGTAAC
AAACACTTACTAAGCAATCATGAGATAGAAATTATGCATGAAGTAGAAGGGATGTCTACGGAAAATGCTCTTGAATTGTTGAGGTGGATGGCTTTTAAAA
ATTACAATGTTCCTTCAAGTTATGAGGAGATTTTAAACCGTGCAGTTGCGTATGCTTTCTGGCCTTCCATTAGCTATAGAAGTCGTGGGTTCCAACTTGT
TTGGAAAGAGTATTGCAGAATGTGAATCTACATTAGATAAGTATGAAAGAATTCCACATGAAAATATCCAAAAGATACTTAAAGTAAGCTTTGATGCTTT
GGACGAAGAACAACAAAGTGTCTTTTTGGATATTGCTTGTTTGTTCAAAGGATGTAGATTGGCAGAAGTCGAAGAGATACTTCAAAGTCATTATGGTTAT
TGCATAAAGAGCGACATTCGAGAGTTGGTTGATAAGTCTCTCATAAAGTGCCACTTGGAAGTGACATTACATGACTTGCTAGAGGTCATGGGTAAAGAAA
TCGTCCGGAAAGAATCACCTAAAA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.41575.1.S1_at:324:543GCAAAGTTATCATTACCACTCGTAA324543287Antisense
Mtr.41575.1.S1_at:57:229ACACTTACTAAGCAATCATGAGATA57229315Antisense
Mtr.41575.1.S1_at:650:863GGATGTCTACGGAAAATGCTCTTGA650863362Antisense
Mtr.41575.1.S1_at:316:453CGTGCAGTTGCGTATGCTTTCTGGC316453451Antisense
Mtr.41575.1.S1_at:747:145AGTTGCGTATGCTTTCTGGCCTTCC747145456Antisense
Mtr.41575.1.S1_at:137:973TGCGTATGCTTTCTGGCCTTCCATT137973459Antisense
Mtr.41575.1.S1_at:489:651GAGATACTTCAAAGTCATTATGGTT489651686Antisense
Mtr.41575.1.S1_at:538:849GGTTATTGCATAAAGAGCGACATTC538849707Antisense
Mtr.41575.1.S1_at:374:633GAGCGACATTCGAGAGTTGGTTGAT374633721Antisense
Mtr.41575.1.S1_at:88:323AAGTCTCTCATAAAGTGCCACTTGG88323746Antisense
Mtr.41575.1.S1_at:318:49ATAAAGTGCCACTTGGAAGTGACAT31849755Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
"TC109657 /FEA=mRNA /DEF=weakly similar to UP|Q9FVK3 (Q9FVK3) Resistance protein MG63 (Fragment), partial (43%)"
Representative public ID: TC109657
Gene mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
TC109657 (weakly similar to UP|Q9FVK3 (Q9FVK3) Resistance protein MG63 (Fragment), partial (43%))
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
GO annotations
No information available (unannotated without homolog)
KEGG annotations
KEGG annotations are based on the GeneBins database Link
BincodeName
4.2.5 SearchApoptosis [CLASS:04210] [PATH:hsa04210] [GO:0006915] ( Evidence )
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC