Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.6489.1.S1_at Involves in at least one biological pathways  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.6489.1.S1_at
CATTTATAATAAATCATGGAGGATGTTAAGGTTTTTGGTCTATGGTCAAGTCCATATACTCAGAGGGTTGTGTGGACATTAAAATTAAAGGGTGTGAGTT
ATGAGTATTATGGTGAAGATCTTGCAAATAAGAGTAGCCTGTTACTGCAATACAATCCAATCTACAAGAAGGTTCCTGTTCTTGTACATAATGGAAAACC
AATGGCAGAGTCAATGGTTATTGTTGAATATATTGATGAGACTTGGCCTCCGTTCCCTCTATTGCCACAAGATGCTTATGAGAGGTCCAATGTTCGTTTC
TGGTCAAAATTCATCGAGGAAAAGTCAATGCACATGATGGAATTTTTTCTGTATGATGGAGAACGACAAGAGAGAGCAATAAAAGAAACTTTGGAAACTT
TGAGAGTGATTGAAAAGGAAAGTGGACTTANTGAAAAGATGTTCATTGGTGGCAACACAATTGGATTGGCAGACATAGCCTTGGGTTGGGGTGGCACATA
CTCTGCCAGTCATGGAAGAAATTGGTTGGAGTCAAGTTCCATTACAATTGATGCATTTCCCCACCTTCACTCTTGGGTGAAGAATTTCTTGGGAAATTCC
TGCTATAAAAACAATCTTNCCCCCCATGAACTACTTGTTGAGTACCTTCAAGGAAANGANGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.6489.1.S1_at:951:761GTAGCCTGTTACTGCAATACAATCC951761146Antisense
Mtr.6489.1.S1_at:1100:169AGAAGGTTCCTGTTCTTGTACATAA1100169179Antisense
Mtr.6489.1.S1_at:535:7ATTGATGAGACTTGGCCTCCGTTCC5357244Antisense
Mtr.6489.1.S1_at:911:985TCCCTCTATTGCCACAAGATGCTTA911985266Antisense
Mtr.6489.1.S1_at:116:663GAGGTCCAATGTTCGTTTCTGGTCA116663294Antisense
Mtr.6489.1.S1_at:385:675GATGTTCATTGGTGGCAACACAATT385675450Antisense
Mtr.6489.1.S1_at:518:1159TTGGATTGGCAGACATAGCCTTGGG5181159473Antisense
Mtr.6489.1.S1_at:1079:887GGCACATACTCTGCCAGTCATGGAA1079887505Antisense
Mtr.6489.1.S1_at:1099:853GGTTGGAGTCAAGTTCCATTACAAT1099853536Antisense
Mtr.6489.1.S1_at:699:19ATTACAATTGATGCATTTCCCCACC69919553Antisense
Mtr.6489.1.S1_at:628:587GAACTACTTGTTGAGTACCTTCAAG628587640Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
"BQ146269 /FEA=mRNA /DEF=weakly similar to UP|Q9FQE3 (Q9FQE3) Glutathione S-transferase GST 15 (Fragment) , partial (48%)"
Representative public ID: BQ146269
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
BQ146269 weakly similar to UP|Q9FQE3 (Q9FQE3) Glutathione S-transferase GST 15 (Fragment) , partial (48%)
AC166707_13.4 IPR004045: Glutathione S-transferase, N-terminal IPR004046: Glutathione S-transferase, C-terminal IPR010987: Glutathione S-transferase, C-terminal-like IPR012336: Thioredoxin-like fold
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr1g090150.1 Unknown Protein (AHRD V1); contains Interpro domain(s) IPR004046 Glutathione S-transferase, C-terminal chr01_pseudomolecule_IMGAG_V3.5 24838264-24839954 E EGN_Mt100125 20100825
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max GmaAffx.21790.1.S1_at Glyma04g10530.1; Glyma04g10540.1 2e-26 116
Glycine max Gma.1502.2.S1_x_at 4e-25 111
Glycine max Gma.1502.2.S1_a_at Glyma05g29400.1 5e-25 111
Glycine max GmaAffx.90567.1.S1_at 8e-23 103
Glycine max Gma.16720.1.S1_at Glyma01g26220.1 1e-22 103
Lotus japonicus chr5.CM0909.59_at Link chr5.CM0909.260.nc 2e-67 219
Lotus japonicus chr5.CM0909.46_at Link chr5.CM0909.180.nc 3e-33 101
Lotus japonicus chr5.CM0909.43_at Link chr5.CM0909.150.nc 6e-33 101
Lotus japonicus chr4.CM0046.42_at Link chr4.CM0046.430.nc 1e-31 106
Lotus japonicus chr5.CM0909.51_at Link chr5.CM0909.210.nc 2e-30 107
GO annotations
Go TermGo NameEvidence
Search Link GO:0004364 glutathione transferase activity Deborah Samac (2009): BLAST TC123131 (evalue 0) against TAIR Arabidopsis genes. Top hit AT2G29420.1, e-value 3.00E-48.
Search Link GO:0005515 protein binding Ji He (2008): BLAST against GO reference database. UNIPROTKB|Q18938 (- symbol:MAAI_CAEEL "gst-42, D1053.1: Probable maleylacetoacetate isomerase" species:6239 "Caenorhabditis elegans" [GO:0005515 "protein binding" evidence=IPI] [GO:0042802 "identical protein binding" evidence=IPI] UniProtKB:Q18938), evalue 8e-011, bit score 65
Search Link GO:0009407 toxin catabolic process Deborah Samac (2009): BLAST TC123131 (evalue 0) against TAIR Arabidopsis genes. Top hit AT2G29420.1, e-value 3.00E-48.
Search Link GO:0009751 response to salicylic acid stimulus Deborah Samac (2009): BLAST TC123131 (evalue 0) against TAIR Arabidopsis genes. Top hit AT2G29420.1, e-value 3.00E-48.
Search Link GO:0042802 identical protein binding Ji He (2008): BLAST against GO reference database. UNIPROTKB|Q18938 (- symbol:MAAI_CAEEL "gst-42, D1053.1: Probable maleylacetoacetate isomerase" species:6239 "Caenorhabditis elegans" [GO:0005515 "protein binding" evidence=IPI] [GO:0042802 "identical protein binding" evidence=IPI] UniProtKB:Q18938), evalue 8e-011, bit score 65
Protein domains
Domain IDDomain NameEvidence
IPR004045 Glutathione S-transferase, N-terminal InterProScan of corresponding IMGAG v2 gene AC166707_13.4
IPR004046 Glutathione S-transferase, C-terminal InterProScan of corresponding IMGAG v2 gene AC166707_13.4
IPR010987 Glutathione S-transferase, C-terminal-like InterProScan of corresponding IMGAG v2 gene AC166707_13.4
IPR012335 Thioredoxin fold InterProScan of corresponding IMGAG v2 gene AC166707_13.4
IPR012336 Thioredoxin-like fold InterProScan of corresponding IMGAG v2 gene AC166707_13.4
IPR017933 Glutathione S-transferase/chloride channel, C-terminal InterProScan of corresponding IMGAG v2 gene AC166707_13.4
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
1.11.10.4 Search E5.2.1.2, maiA maleylacetoacetate isomerase [EC:5.2.1.2] [COG:COG0625] [GO:0016034] COG: Homolog to CC3568 (5e-10): COG0625
1.5.12.8 Search E5.2.1.2, maiA maleylacetoacetate isomerase [EC:5.2.1.2] [COG:COG0625] [GO:0016034] COG: Homolog to CC3568 (5e-10): COG0625
1.6.9.16.1 Search GST glutathione S-transferase [COG:COG0625] COG: Homolog to CC3568 (5e-10): COG0625
2.3.1.70 Search SSPA stringent starvation protein A [COG:COG0625] COG: Homolog to CC3568 (5e-10): COG0625
3.2.2.120 Search E2.5.1.18, gst glutathione S-transferase [EC:2.5.1.18] [COG:COG0625] [GO:0004364] COG: Homolog to CC3568 (5e-10): COG0625||Gene Ontology: Homolog to GO_ID:19789 (3e-47): TAIR|gene:2043111 SPTR:Q9ZW24 symbol:AT2G29420.1 [GO:0004364 "glutathione transferase activity" evidence=ISS] InterPro:IPR004045 InterPro:IPR004046 Pfam:PF00043 Pfam:PF02798 HSSP:O65032 EMBL:AC004561 EMBL:AY045679 EMBL:AY056086 EMBL:AY086358 EMBL:AF288188 PIR:B84696 SPTR:Q9ZW24||KEGG: Homolog to ath:At2g29450 (8e-42): F16P2.17; glutathione S-transferase (103-1A) [EC:2.5.1.18] [KO:K00799]||Swiss-Prot: Homolog to GSTX2_TOBAC (2e-46): Auxinsignalingpathway; Multigenefamily; Transferase,Probable glutathione S-transferase (EC 2.5.1.18) (Auxin-induced protein PGNT35/PCNT111).
Biological pathways
Based on the MedicCyc database Link, this transcript is involved in at least one biological pathways. To see details, click here and in the search box, input Mtr.6489.1.S1_at.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC