Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.15996.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.15996.1.S1_at
ATGGAATGGAGAGAGAGGAGAGGTAGACAAGCAAGAAGAAGAAGTGGAAGCGTGATCGGTGTGATAAGAGAATTGCGTTCAAGGAAGTCGCGTGCTAGAG
TAGAGCTTTGGCTGGTTATGAGCGTACCAGGTCAAAAAGGTTATGGTTGGATGGATTTCTCAAACCACTCTGTCCTTACTAGAAAAGATCGCTTTGATCT
AGAAGAAGTAATGTGTGATAAAGAACTAAATCTAAGAACCAACATTTATGAGATCCTTTTGCAAGAGTCGTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.15996.1.S1_at:277:303AAGCGTGATCGGTGTGATAAGAGAA27730360Antisense
Mtr.15996.1.S1_at:195:375CAAGGAAGTCGCGTGCTAGAGTAGA19537592Antisense
Mtr.15996.1.S1_at:666:463CGCGTGCTAGAGTAGAGCTTTGGCT666463101Antisense
Mtr.15996.1.S1_at:49:179AGCTTTGGCTGGTTATGAGCGTACC49179116Antisense
Mtr.15996.1.S1_at:439:849GGTTATGAGCGTACCAGGTCAAAAA439849126Antisense
Mtr.15996.1.S1_at:857:329AAGGTTATGGTTGGATGGATTTCTC857329149Antisense
Mtr.15996.1.S1_at:917:863GGATGGATTTCTCAAACCACTCTGT917863161Antisense
Mtr.15996.1.S1_at:566:383CAAACCACTCTGTCCTTACTAGAAA566383173Antisense
Mtr.15996.1.S1_at:322:789GTCCTTACTAGAAAAGATCGCTTTG322789184Antisense
Mtr.15996.1.S1_at:523:687GATCGCTTTGATCTAGAAGAAGTAA523687199Antisense
Mtr.15996.1.S1_at:684:431CTAAGAACCAACATTTATGAGATCC684431244Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|810.m00025 /FEA=mRNA /DEF=Gastrin/cholecystokinin peptide hormone AC126790.38.241 122877 122329 mth2-10d14 01/13/05
Representative public ID: IMGAG|810.m00025
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
AC202482_17.4 IPR001651: Gastrin/cholecystokinin peptide hormone
AC126790_25.5 IPR001651: Gastrin/cholecystokinin peptide hormone
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max Gma.4945.1.S1_at Glyma16g34520.1 0.0000000000008 50.6
GO annotations
Go TermGo NameEvidence
Search Link GO:0003674 molecular_function Deborah Samac (2009): BLAST NP7263647 (evalue 1.00E-153) against TAIR Arabidopsis genes. Top hit AT3G17740.1, e-value 2.00E-10.
Protein domains
Domain IDDomain NameEvidence
IPR013152 Gastrin/cholecystokinin, conserved site InterProScan of corresponding IMGAG v2 gene AC126790_25.5
IPR013152 Gastrin/cholecystokinin, conserved site InterProScan of corresponding IMGAG v2 gene AC202482_17.4
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC