Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.51446.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.51446.1.S1_at
ATGATGCACTGTGTAACCATTGCTGGAAAAAATGAAGGCAAAAGCTGTATGTTTTCCGTGAGAACTTTCCACAAACGCCTGGCACAAGAGCCACAATCTG
CAATTTCAACACAGCTCATTTCTGAAACAGAATACTCAGTACAATACAGCAGTAAAACTAGGAAGAAGATGGTATATCAGCGATGCAGAGATTGGGGGTA
TACATATGTGCACGATTACTTAACATACATGATTCACAAAGGCGAGAGCATAGAAACGAGAAGACGAAGACGACGATTCACAAAGGCCAGAGCACGAAAA
CGAGAAGACGACCACGCCGCTGGTTCACTAGTTCACAACAAATGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.51446.1.S1_at:1128:679GATGCACTGTGTAACCATTGCTGGA112867915Antisense
Mtr.51446.1.S1_at:867:257AAAGCTGTATGTTTTCCGTGAGAAC86725753Antisense
Mtr.51446.1.S1_at:337:799GTGAGAACTTTCCACAAACGCCTGG33779970Antisense
Mtr.51446.1.S1_at:392:261AAACGCCTGGCACAAGAGCCACAAT39226185Antisense
Mtr.51446.1.S1_at:221:633GAGCCACAATCTGCAATTTCAACAC221633100Antisense
Mtr.51446.1.S1_at:811:961TGCAATTTCAACACAGCTCATTTCT811961111Antisense
Mtr.51446.1.S1_at:166:671GATGGTATATCAGCGATGCAGAGAT166671180Antisense
Mtr.51446.1.S1_at:1130:827GGGTATACATATGTGCACGATTACT1130827208Antisense
Mtr.51446.1.S1_at:705:1043TACATGATTCACAAAGGCGAGAGCA7051043238Antisense
Mtr.51446.1.S1_at:924:159AGACGACGATTCACAAAGGCCAGAG924159280Antisense
Mtr.51446.1.S1_at:122:469CCGCTGGTTCACTAGTTCACAACAA122469329Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
"IMGAG|839.m00010 /FEA=mRNA /DEF=Peptidase, eukaryotic cysteine peptidase active site AC131248.14.91 45231 45575 mth2-28n22 01/13/05"
Representative public ID: IMGAG|839.m00010
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr2g035900.1 Unknown Protein (AHRD V1) chr02_pseudomolecule_IMGAG_V3.5 12789953-12788327 E EGN_Mt100125 20100825
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC