Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.48962.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.48962.1.S1_at
ATGAAGAGCTTTTGCCCCAAATTTTCTTTTCTCTTATTGATTACTCTTATTTTAACAAGTTTCTTGTATTCTGAGGCTCAAAAGTGTCGTCCAAACGGTA
GAATCAGGGGAAAGAAAGCTCCATCGGGACAATGCAACAAAGAGAATGACTCTGATTGTTGTGTACAAGGAAAGATGTACACAACTTATGAATGTTCACC
ATCAGTGTCTACTCATACTAAGGCATACCTCACACTTAACAGTTTCCAGAAAGGTGGAGATGGAGGCGGACCTTCAGCGTGTGATAATCAATATCATTCT
GATGACACTCCAGTTGTTGCACTTTCCACCGGATGGTTCAACGACAAGAGCAGATGTCTCAACAAGATTACCATAAGTGCCAATGGAAGAAGTGTAGTGG
CCACTGTGGTTGATGAGTGTGACTCTACGATGGGATGTGATGAAGAACATGATTACCAACCTCCTTGTCCAAACAACATTGTTGATGCTTCCAAGGCTGT
GTGGAAAGCCTTGGGTGTGCCTCAAGATCAATGGGGTGGCCTTGACATTACATGGTCAGATGCTTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.48962.1.S1_at:1118:375CAAGTTTCTTGTATTCTGAGGCTCA111837568Antisense
Mtr.48962.1.S1_at:409:321AAGTTTCTTGTATTCTGAGGCTCAA40932169Antisense
Mtr.48962.1.S1_at:1028:141AGTTTCTTGTATTCTGAGGCTCAAA102814170Antisense
Mtr.48962.1.S1_at:1065:745GTTTCTTGTATTCTGAGGCTCAAAA106574571Antisense
Mtr.48962.1.S1_at:635:1093TTTCTTGTATTCTGAGGCTCAAAAG635109372Antisense
Mtr.48962.1.S1_at:1074:1123TTCTTGTATTCTGAGGCTCAAAAGT1074112373Antisense
Mtr.48962.1.S1_at:450:1009TCTTGTATTCTGAGGCTCAAAAGTG450100974Antisense
Mtr.48962.1.S1_at:696:57ATCAGTGTCTACTCATACTAAGGCA69657213Antisense
Mtr.48962.1.S1_at:844:1015TCAGTGTCTACTCATACTAAGGCAT8441015214Antisense
Mtr.48962.1.S1_at:359:401CAGTGTCTACTCATACTAAGGCATA359401215Antisense
Mtr.48962.1.S1_at:1057:131AGTGTCTACTCATACTAAGGCATAC1057131216Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|864.m00027 /FEA=mRNA /DEF=Barwin-related endoglucanase AC135311.13.271 98417 98983 mth2-27l9 01/13/05
Representative public ID: IMGAG|864.m00027
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
AC202495_20.3 IPR009009: Barwin-related endoglucanase
AC135311_27.4 IPR009009: Barwin-related endoglucanase
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr4g036300.1 Ripening-related protein 3 (AHRD V1 *-*- Q9FWT5); contains Interpro domain(s) IPR009009 Barwin-related endoglucanase chr04_pseudomolecule_IMGAG_V3.5 11338277-11341588 H EGN_Mt100125 20100825
IMGA|Medtr7g076990.1
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Lotus japonicus Ljwgs_073893.1_at Link LjSGA_073893.1 7e-30 124
Lotus japonicus Ljwgs_034066.1_at Link LjSGA_034066.1 0.00000001 44.1
GO annotations
No information available
Protein domains
Domain IDDomain NameEvidence
IPR009009 Barwin-related endoglucanase InterProScan of corresponding IMGAG v2 gene AC135311_27.4
IPR009009 Barwin-related endoglucanase InterProScan of corresponding IMGAG v2 gene AC202495_20.3
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC