Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.6327.1.S1_at Predicted as a legume specific gene  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.6327.1.S1_at
TTTCAATTTTCATTCTTCTTCTTACATTACAATACAATACAACAAACTGTTCTTCACTTTCAACATCTTTTCTCATCCCACTCTCACCAACCAAACCAGA
TGGACCCCACACCTTCCTTTCACCGTCGATTTCCCTCCTCCTCCGACCGCCTACTCGGCGCCTTCAACTTCTCCCCTTCCACCACCTCCGCCGCCGCCGG
CGATGAGCTCACCGAAGCCTGAACTTTTCAACTGGTCCTCCGACAGCTCCGAATCTGAAAATCAACAACGTCCACCACCTCAACCGAAGGAGCTTACCCG
TCATCGGAGTTTT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.6327.1.S1_at:1008:1039TACAACAAACTGTTCTTCACTTTCA1008103950Antisense
Mtr.6327.1.S1_at:706:1121TTCACTTTCAACATCTTTTCTCATC706112165Antisense
Mtr.6327.1.S1_at:173:1097TTTCAACATCTTTTCTCATCCCACT173109770Antisense
Mtr.6327.1.S1_at:572:211ACTCTCACCAACCAAACCAGATGGA57221192Antisense
Mtr.6327.1.S1_at:724:897GGCGATGAGCTCACCGAAGCCTGAA724897211Antisense
Mtr.6327.1.S1_at:216:951TGAGCTCACCGAAGCCTGAACTTTT216951216Antisense
Mtr.6327.1.S1_at:83:581GAAGCCTGAACTTTTCAACTGGTCC83581226Antisense
Mtr.6327.1.S1_at:144:587GAACTTTTCAACTGGTCCTCCGACA144587233Antisense
Mtr.6327.1.S1_at:243:983TCCTCCGACAGCTCCGAATCTGAAA243983248Antisense
Mtr.6327.1.S1_at:1158:509GCTCCGAATCTGAAAATCAACAACG1158509258Antisense
Mtr.6327.1.S1_at:935:1019TCAACCGAAGGAGCTTACCCGTCAT9351019292Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
"BQ139547 /FEA=mRNA /DEF=weakly similar to GB|AAG27959.1|11055109|AF187542 protamine P1 {Onychogalea fraenata;} , partial (48%)"
Representative public ID: BQ139547
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
BQ139547 weakly similar to GB|AAG27959.1|11055109|AF187542 protamine P1 {Onychogalea fraenata;} , partial (48%)
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is predicted as legume specific.
Homolog transcripts
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC