Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Sme.168.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Sme.168.1.S1_at
ATGGCTAGGATCGAGAAAACAGAACTGCGAATGGTGGATCTTCCGCCGAAAAACAAGCGGACCGATGCCATCCAGAGCTTCGTGAGCCAGGAGACGCCGA
TCGTCACGATCACGGATGCCGACGGCGCGACCGGCACGGGCTACAGCTACACGATCGGCACCGGCGGATCCTCCGTCATGCGGCTGCTCTCCGATCACCT
GGTTCCGATCCTGCTCGGGGAAGATGCGGACTGCATCGAGGCACTTTGGCAGAAGATGGAGTTCGCGACGCATGCGACGACCATCGGCGCCATCACGGCC
TTGGCGCTCGCCGCCGTGGACACGGCGCTATGGGACCTGCGGGCGAAGAAGCAGAAGCTGCCGCTCTGGAAACTGGCGGGTGGGGCGAAGGAAAGCTGCC
CGCTTTACACCACCGAGGGCGGCTGGCTGCACATCGAAAAACAGGCCCTCGTAGACGACGCATTGCAGGCGAAGGCCAACGGTTTCTCCGGATCGAAGGT
CAAGATCGGCAAGCCGAGCGGGGCGGAGGATTACGATAGGCTCTCAGCCATGCGCGCAGCCCTTGGCGACGGCTTTGAAATCATGACGGATTGCAACCAG
GGCTTCACCGTCGACGAGGCGATCCGCCGCGCCGCCCGGCTCCGCGAGCTTGATCTCGCCTGGATCGAGGAACCGTTGCCGGCGGACGATCTCGACGGCC
ACATCCGTCTGACGCGGTCGACGCCGACGCCGATCGCCGTCGGCGAATCCATCTATTCGATCCGCCATTTCCGCGAATATATGCAGAAGGGCGCCTGCTC
GATCGTCCAGGTGGACGTGGCGCGGATCGGCGGCATCACCCCCTGGCTGAAAGTGGCCCATGCGGCGGAAGCCTTCGACATTCCCGTCTGCCCGCATTTC
CTGATGGAACTGCATGTGAGCCTCGTTTGCGCGGTGCCCAATGGGAAGTATGTCGAGTACATTCCGCAGCTCGATGATCTGACGCAGATGGGAATGGAGA
TCCGGGAGGGCAGGGCGATCGCGCCCTCCAATCCCGGCATCGGCATCGCCTGGGACTGGGAAGCGGTAAAGGCGCGCTCGGTCGCCGAGTTCACCCGCGA
GTTCCGCCGGTAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Sme.168.1.S1_at:400:563GAATGGTGGATCTTCCGCCGAAAAA40056341Antisense
Sme.168.1.S1_at:900:683GATGCCATCCAGAGCTTCGTGAGCC90068376Antisense
Sme.168.1.S1_at:841:205ACGGGCTACAGCTACACGATCGGCA841205148Antisense
Sme.168.1.S1_at:623:79ATGCGGACTGCATCGAGGCACTTTG62379236Antisense
Sme.168.1.S1_at:218:577GAAGCAGAAGCTGCCGCTCTGGAAA218577360Antisense
Sme.168.1.S1_at:1143:127AGGGCGGCTGGCTGCACATCGAAAA1143127428Antisense
Sme.168.1.S1_at:732:663GAGGATTACGATAGGCTCTCAGCCA732663538Antisense
Sme.168.1.S1_at:849:473CCTTGGCGACGGCTTTGAAATCATG849473573Antisense
Sme.168.1.S1_at:683:953TGACGGATTGCAACCAGGGCTTCAC683953596Antisense
Sme.168.1.S1_at:656:991TCGTTTGCGCGGTGCCCAATGGGAA656991935Antisense
Sme.168.1.S1_at:182:757GTATGTCGAGTACATTCCGCAGCTC182757960Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
TIGR|NT01SMB0904 /FEA=mRNA /DEF=putative mandelate racemase or evolutionary related enzyme of the mandelate racemase muconate lactonizing enzyme family protein {Sinorhizobium meliloti 1021}
Representative public ID: TIGR|NT01SMB0904
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
Go TermGo NameEvidence
Search Link GO:0016853 isomerase activity Ji He (2008): BLAST against GO reference database. TIGR_CMR|PFL_1526 (- symbol:PFL_1526 "mandelate racemase/muconate lactonizing enzyme family protein" species:220664 "Pseudomonas fluorescens Pf-5" [GO:0016853 "isomerase activity" evidence=ISS] [GO:0019439 "aromatic compound catabolic process" evidence=ISS] UniProtKB:Q4KGI0), evalue 3e-024, bit score 111
Search Link GO:0019439 aromatic compound catabolic process Ji He (2008): BLAST against GO reference database. TIGR_CMR|PFL_1526 (- symbol:PFL_1526 "mandelate racemase/muconate lactonizing enzyme family protein" species:220664 "Pseudomonas fluorescens Pf-5" [GO:0016853 "isomerase activity" evidence=ISS] [GO:0019439 "aromatic compound catabolic process" evidence=ISS] UniProtKB:Q4KGI0), evalue 3e-024, bit score 111
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC