Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Sme.5543.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Sme.5543.1.S1_at
ATGAACCGGCGGGCGCGTTACCGGAGATCTTGGGCGGGTTGGCCCGACCCAAGGACGGCATGGCGATTCGAAGCGCGGGAAAACACCTTTCCACCATTGG
TTCGCGCGGCGGTTCGTTCTATTTTCGCAGCTACGAACGAATCGTCGGCGGAAAAGCATGCGACAATATCTCGATCTCCTCGAACATGTGATCACAACGG
GTACCGACCGGGGCGACCGTACGGGTACGGGCACGCGCTCGGTGTTCGGCTACCAGATGCGCTTCGACCTGTCGCAGGGTTTCCCGGTGCTGACCACCAA
GAAGCTGCATCTGCGTTCGATCATTCACGAGCTTCTGTGGTTCCTCAGGGGCGACACGAACGTCGCCTATCTCAAGGACAACGGGGTGAGCATCTGGGAC
GAATGGGCGGACGAAAACGGCGAGCTCGGACCGGTCTACGGCTACCAATGGCGCTCCTGGCCGACGCCCGATGGCCGACATATCGACCAGATCGCGGCGC
TGGTCGAAGGCCTGAAGACCAATCCGAATTCCCGCCGCCACATCGTTTCGGCCTGGAACCCGGCGCTTGTGGACGAAATGGCGCTGCCGCCATGCCACTG
TCTGTTCCAGTTCTACGTGGCGGACGGGAAGCTCTCCTGCCAGCTCTACCAGCGCTCGGCCGATATCTTTCTCGGCGTACCCTTCAATATCGCTTCCTAC
GCTCTGCTGACGATGATGGTGGCGCAGGTGACTGGGCTCGAAGCCGGCGATTTCGTTCATACGCTTGGTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Sme.5543.1.S1_at:421:1111TTGGCCCGACCCAAGGACGGCATGG421111151Antisense
Sme.5543.1.S1_at:1161:373CAAGGACGGCATGGCGATTCGAAGC116137362Antisense
Sme.5543.1.S1_at:347:1139TTCCACCATTGGTTCGCGCGGCGGT3471139101Antisense
Sme.5543.1.S1_at:763:451CGGTTCGTTCTATTTTCGCAGCTAC763451122Antisense
Sme.5543.1.S1_at:71:1135TTCGCAGCTACGAACGAATCGTCGG711135136Antisense
Sme.5543.1.S1_at:40:559GAATCGTCGGCGGAAAAGCATGCGA40559151Antisense
Sme.5543.1.S1_at:816:529GCATGCGACAATATCTCGATCTCCT816529168Antisense
Sme.5543.1.S1_at:209:991TCGATCTCCTCGAACATGTGATCAC209991183Antisense
Sme.5543.1.S1_at:651:403CATGTGATCACAACGGGTACCGACC651403197Antisense
Sme.5543.1.S1_at:1117:199ACGCGCTCGGTGTTCGGCTACCAGA1117199245Antisense
Sme.5543.1.S1_at:832:937TGTTCGGCTACCAGATGCGCTTCGA832937255Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
TIGR|NT01SM2927 /FEA=mRNA /DEF=hypothetical protein {Sinorhizobium meliloti 1021}
Representative public ID: TIGR|NT01SM2927
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
Go TermGo NameEvidence
Search Link GO:0004799 thymidylate synthase activity Ji He (2008): BLAST against GO reference database. TIGR_CMR|HNE_0459 (- symbol:HNE_0459 "thymidylate synthase" species:228405 "Hyphomonas neptunium ATCC 15444" [GO:0004799 "thymidylate synthase activity" evidence=ISS] [GO:0009265 "2'-deoxyribonucleotide biosynthetic process" evidence=ISS] UniProtKB:Q0C504), evalue 3e-083, bit score 306
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC