Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.45992.1.S1_at Involves in at least one biological pathways  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.45992.1.S1_at
ATGCCATCCTTAACCCTTGTTGTGGTGTTACTAATACTGATATTCTCGTACAATGTAGATGGTGATGTTGAACATCAAGAGTCATGTTCAAGAAGGTGCG
GTGTTCATAGCATCAGCCACCCTTTCCGATTGAAAGACAGTCCTGAAAAGTGTGGTGACAAAAGGTACATCCTATCATGTGAGGACAATAACCAATTGAT
TTTGTACTATGAATTTGAAGAATACCATGGAAAATACTATGTACAATCAATTAATTACAACAACTTCACCATACGACTATTGGATTTCAATCTTGCTTCT
TCTAATAATTCCATCCCTTCTTATTATTCTTTAGGGCTTTATAATTTCAGTTCTAATTTCTTCACCTCACCCTACCTAGCCTATCATCGATACAAAAACT
ACACTAATCATATGTTGACGAAATCTATGTTATATGTGAGCTGTCCGAATCGGATGGAATATTCATACATTGGTAATTGTATGAATAGAACTTCATATTC
ACAGGATGTGAATTCTTTCTATGTTGGTGGCTATGGTAAATCTCTGTTGGAATTTGGGTTGGGAGACGGGTGTCATATAGAGTTTATGTATCTCACTTGG
GATGTTGAAGATGATGGCAACATCAACAACATTTCTTGTACAGACATTCGTCGTAGGATGTATTATGGATTTGAACTTTCTTGGCTCAACAGTCGGTGTA
AACATGGTCGGTATGCAGTGCTCGATCAATATAACCAGCCTCACTGTAAATATGATTACTGGAATAACGCGGCTTGGATAGTTGCACGTTTATCATTCGG
CTTAGGTGTATTGGTTGGTTTGCTTAGCGGTGTTAAATTTGTTCTTGGATTGCCATTTATCATTGTATTATTAATCAAAAAATGGCGAAAGAAACATCAA
TCTATGTATGATGGCGTCGAAGATTTTCTAAGTAGTGATAATAGCATCATCCCTATAAGGTACTCTTACAAAGAGATAAAAAAGATAACCGGAAATTTCA
TGACAAAACTAGGCAATGGAGGTTATGGATCTGTTTTCAAAGGACAACTTCGAAGTGGTCGTCTTGTAGCAGTCAAATTATTGGACAGTGCCAAGTCCAA
CGATCGAGATTTTGTCAATGAAGTTGCTACCATTGGTAGGATTCACCATGTTAATGTGGTACAACTCATTGGTTTCTGTGTGGAAGGTTCAAAACGTGTT
CTGATATATGAATTTATGCCAAATGGATCACTAGAAAAATACATATTTTCTCATACCGAAGAGAATTATTCCTTGAGTTGCGAACAATTGTATTCAATTT
CACTTGGAGTGGCTCGTGGCATTGAGTACTTGCACAATGGATGCAATATGAAAATTCTACACTTTGACATAAAGCCTCATAACATCCTTCTTGATGAAAA
TTTCAATCCAAAAGTTTCTGATTTTGGACTTGCTAGACTTTGTCCTACAGATAAAAGCATTGTGTCATTAACTGCAGCAAGAGGAACCATTGGATACATG
GCCCCTGAACTATTCTACCGAAATGTCGGCACGATATCTTACAAAGCTGATGTTTATAGTTTTGGGATGTTGTTAATGGAGATGGCAAATAGAAGGAAGA
ACTTGGATGTATTGGCTGGTCAATCTAGCCAGGTTTATTTCCCTTTTTGGGTTTATGATCAGTTACAAGATGGAAGAGAAATAACAATTGAGAATGCTAC
AAATCATGAGATGAAATTGGCAAAGAAAATGATGATAGTGGCTTTGTGGTGTATTCAAGCGAAACCTAGTGATCGTCCTCCAATGGATAAAGTGTTGGAG
ATGCTTGAAGAAGAAGATGAAGATTTGCAAATGCCTAATCAGCCTGACCTTGATGCACAAGACGTACGAGATGATAGAACTGGTAGTTCATTGTATTCCT
CTGGTACATTAGTAACTGATTCCAAGGAACCAATTTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.45992.1.S1_at:295:167AGAACTTGGATGTATTGGCTGGTCA2951671610Antisense
Mtr.45992.1.S1_at:596:861GGATGTATTGGCTGGTCAATCTAGC5968611617Antisense
Mtr.45992.1.S1_at:519:899GGCTGGTCAATCTAGCCAGGTTTAT5198991626Antisense
Mtr.45992.1.S1_at:331:641GAGAATGCTACAAATCATGAGATGA3316411702Antisense
Mtr.45992.1.S1_at:1125:245AAATGCCTAATCAGCCTGACCTTGA11252451841Antisense
Mtr.45992.1.S1_at:293:353AATCAGCCTGACCTTGATGCACAAG2933531849Antisense
Mtr.45992.1.S1_at:688:187AGCCTGACCTTGATGCACAAGACGT6881871853Antisense
Mtr.45992.1.S1_at:219:417CTTGATGCACAAGACGTACGAGATG2194171861Antisense
Mtr.45992.1.S1_at:1139:373CAAGACGTACGAGATGATAGAACTG11393731870Antisense
Mtr.45992.1.S1_at:10:845GGTACATTAGTAACTGATTCCAAGG108451915Antisense
Mtr.45992.1.S1_at:988:19ATTAGTAACTGATTCCAAGGAACCA988191920Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
"IMGAG|1134.m00018 /FEA=mRNA /DEF=Protein kinase; Serine/threonine protein kinase, active site; Tyrosine protein kinase; Protein kinase-like AC146775.8.181 63419 61011 mth2-95g14 01/13/05"
Representative public ID: IMGAG|1134.m00018
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr1g031520.1 Kinase R-like protein (Fragment) (AHRD V1 *-*- Q8W1F1_AEGTA); contains Interpro domain(s) IPR002290 Serine/threonine protein kinase chr01_pseudomolecule_IMGAG_V3.5 9259174-9256745 E EGN_Mt100125 20100825
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max Gma.16705.1.S1_at Glyma13g09740.1 5e-17 83.5
Glycine max Gma.8125.1.S1_at Glyma20g25310.1 0.0000000002 40.1
Glycine max GmaAffx.84794.1.S1_at Glyma10g41820.1 0.0000000002 40.5
Glycine max GmaAffx.90491.1.A1_s_at Glyma09g31370.1; Glyma09g31430.1 0.000000008 37.8
Glycine max GmaAffx.90491.1.S1_at Glyma09g31370.1; Glyma09g31430.1 0.000000008 37.8
Lotus japonicus TM0068.15_at Link LjT06N06.180.nd 3e-26 114
Lotus japonicus TM0068.45_at Link LjT06N06.390.nd 1e-25 112
Lotus japonicus Ljwgs_079005.1_at Link LjSGA_079005.1 2e-18 88.5
Lotus japonicus chr2.CM0210.64_at Link chr2.CM0210.550.nd 6e-18 86.7
Lotus japonicus Ljwgs_068392.1_at Link LjSGA_068392.1 3e-16 81.3
GO annotations
Go TermGo NameEvidence
Search Link GO:0005524 ATP binding Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-033, bit score 142
Search Link GO:0005576 extracellular region Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-033, bit score 142
Search Link GO:0005886 plasma membrane Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-033, bit score 142
Search Link GO:0006468 protein amino acid phosphorylation Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-033, bit score 142
Deborah Samac (2009): BLAST TC128945 (evalue 0) against TAIR Arabidopsis genes. Top hit AT5G38250.1, e-value 2.00E-87.
Search Link GO:0016301 kinase activity Deborah Samac (2009): BLAST TC128945 (evalue 0) against TAIR Arabidopsis genes. Top hit AT5G38250.1, e-value 2.00E-87.
Search Link GO:0019199 transmembrane receptor protein kinase activity Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-033, bit score 142
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
1.1.17.19 Search E2.7.1.- [EC:2.7.1.-] [COG:COG0515 COG1493] COG: Homolog to YJL095w (3e-18): COG0515
1.11.16.8 Search E2.7.1.- [EC:2.7.1.-] [COG:COG0515 COG1493] COG: Homolog to YJL095w (3e-18): COG0515
1.7.8.19 Search WAAY, rfaY lipopolysaccharide core biosynthesis protein RFAY [EC:2.7.-.-] [COG:COG0515] COG: Homolog to YJL095w (3e-18): COG0515
1.9.4.15 Search E2.7.1.- [EC:2.7.1.-] [COG:COG0515 COG1493] COG: Homolog to YJL095w (3e-18): COG0515
3.2.2.1 Search Protein kinase [EC:2.7.1.37] Swiss-Prot: Homolog to PBS1_ARATH (8e-46): ATP-binding; Directproteinsequencing; Kinase; Nucleotide-binding; Phosphorylation; Plantdefense; Serine/threonine-proteinkinase; Transferase,Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1).
3.3.10.117 Search BMPR1 bone morphogenetic protein receptor, type I [EC:2.7.1.37] Swiss-Prot: Homolog to PBS1_ARATH (8e-46): ATP-binding; Directproteinsequencing; Kinase; Nucleotide-binding; Phosphorylation; Plantdefense; Serine/threonine-proteinkinase; Transferase,Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1).
4.2.4 Search Cell cycle [CLASS:04110] [PATH:hsa04110] [COG:COG0515] COG: Homolog to YJL095w (3e-18): COG0515
Biological pathways
Based on the MedicCyc database Link, this transcript is involved in at least one biological pathways. To see details, click here and in the search box, input Mtr.45992.1.S1_at.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC