Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.25726.1.S1_s_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.25726.1.S1_s_at
ATGGCTTCTTCAATTCATTGCTCTGTTTCACTTCCTTCATCACTTCCCAAACTCTCCAATTTCAACTTCAACTTCAACACTACCAACAACAAATTCTTTT
CATTCAACCCATCATCAAATTCAATCAAATGTTCAGCTTCTTCTTTTTCATGTTTCTCTTCAACATCACTCGATGAAACTGCTATGAGCATTGAAAATCT
ACGTAGCTTCATCAACCTCAATATTGGAAAATGGAACGGTTCTTTCTATCAATTTGATGCTGGCGGGAATCTGTTGCAACGAGTGAGTACTAAGCTTTCT
GTTAGCTCTTATGGGGAAGATGAACTCATGAGTCTCATTCAATCGCTGTACATTAAACAACCTTCATCAAATACTTCAGTTTCTGGAGATGACGGTGATG
CAGAATGGGCAGAGTACAAAATTAAAGAAACCAATATGTTTACTGTTGACAAGTACCAACAAATAGGCTTTTTCCCATCCGAGAAAGCATTTGCATTGAG
GTATCAAACAGCTGGTATGTTGGAAACTGTATTACGGCAAGGGGTTCTTGGAGAAGATGACATTGGTGAAGAATCGCCTAGGTCTTTATGTTGCAGAAAT
CTGAAACTTCCCTCTCGTCGACCTTCTCTTGTTTGTGAGAATTGCCTGTACTCTTTACAGAGAGATATGCGAGCAAGAGCTTTTCACATTTTGGAGCCAA
AAGGCACTGTTGATATGCTTATCATCTTCCTAGAGGAAAGAAGTGAGGGGTCTCCTCCTCTACTTGACAGTGCTGGGGACGCAGAGAATAGGATTACACC
GTTTCTTGGTAAATGGAAAGGTCGTTCCGTTACAAACCGAAGTGGTGTCTATGGATCTACAATTTCTGAAGCTGATACAGTTGTGTTACATGAGATGGAT
GACAATGGCCAACTTATTCAGGATGTTACTTGCACATCTGATGGGACAAATGTTACAACCAATGTTCATTGGACTGGCGCAATATCAGACAATTTAGTCA
CATTTGATGGAGGCTATCAAATGATTCTATTACCTGGTGGTATGTACATGGGATGTCCTTGTGATGTTGCAAAAAGTGTTGCACAATCAAAATCTTTCCA
TTTGGAGTTCTGTTGGTTAGAGACACCTGACAAGAGGCAAAGACTGGTTCGCACGTACGATGTTGAAGGCTTGGCCGTCTCATCTACTTATTTTTTAGAG
ACTAAAGTGTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.25726.1.S1_s_at:786:799GTGAGAATTGCCTGTACTCTTTACA786799647Antisense
Mtr.25726.1.S1_s_at:738:637GAGCTTTTCACATTTTGGAGCCAAA738637689Antisense
Mtr.25726.1.S1_s_at:494:197ACCGAAGTGGTGTCTATGGATCTAC494197848Antisense
Mtr.25726.1.S1_s_at:854:607GACAATGGCCAACTTATTCAGGATG854607913Antisense
Mtr.25726.1.S1_s_at:291:95ATGTTACTTGCACATCTGATGGGAC29195935Antisense
Mtr.25726.1.S1_s_at:718:373CAATGTTCATTGGACTGGCGCAATA718373972Antisense
Mtr.25726.1.S1_s_at:350:385CAAATGATTCTATTACCTGGTGGTA3503851030Antisense
Mtr.25726.1.S1_s_at:485:103ATGGGATGTCCTTGTGATGTTGCAA4851031060Antisense
Mtr.25726.1.S1_s_at:506:879GGCAAAGACTGGTTCGCACGTACGA5068791148Antisense
Mtr.25726.1.S1_s_at:841:673GATGTTGAAGGCTTGGCCGTCTCAT8416731171Antisense
Mtr.25726.1.S1_s_at:856:903GGCCGTCTCATCTACTTATTTTTTA8569031185Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
1451.m00029 /FEA=mRNA /DEF=AC147482.2 9306 5249 mth2-93e11 weakly similar to UP|Q9AUW4 (Q9AUW4) Hypothetical protein OSJNBa0040E01.11 (Hypothetical protein OSJNBb0048A17.3)
Representative public ID: 1451.m00029
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
AC147482_2.4 hypothetical protein
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr6g013150.1 Unknown Protein (AHRD V1); contains Interpro domain(s) IPR015741 Snf1-like protein AMPK chr06_pseudomolecule_IMGAG_V3.5 3295361-3290979 F EGN_Mt100125 20100825
IMGA|Medtr6g013150.2
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Lotus japonicus Ljwgs_076928.1_at Link LjSGA_076928.1 2e-40 162
GO annotations
Go TermGo NameEvidence
Search Link GO:0003674 molecular_function Deborah Samac (2009): BLAST TC113152 (evalue 0) against TAIR Arabidopsis genes. Top hit AT3G29185.2, e-value 1.00E-117.
Search Link GO:0008150 biological_process Deborah Samac (2009): BLAST TC113152 (evalue 0) against TAIR Arabidopsis genes. Top hit AT3G29185.2, e-value 1.00E-117.
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC