Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.42971.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.42971.1.S1_at
GGCACGAGGCAAAATTCGAAAGGAGAGAGAGAGAGAGAGAGAGAATGTCTTCATCGGTATCTGGGAATATGAAGGGCTTCTACAAGCAGAAGAAAAACAC
CAATCTCACCACCACCGCCAAATCATCCAAGTCCATAAAACCTCCAACTCACGCCTCCACTTCACCATCCCTCAACACCAACCCAGATCTCCAAGATGAA
CACAACGGCAGCGAGGCTGTGCTTCGACAATTTGACATGAACATGAAGTATGGGCCTTGTATGGGGATGACGAGGCTGGCACGCTTGGAGCGTGCTGTGA
AGCTTGGTTTGAACCCTCCGGAGGAAATCGCGGAACTCTTGAAGAGTGGTAAAGTTCAGCAAGAATCACTTTGGGACACTCGCATTTAGAACGCTGCTTA
AATGTAATAATCTTGTTGTAGCTTCTTCTGACTTGTTTGTTTGTTTAGGTTTTGCTTAGGGAAAATCACTTTCTTGCTGTGTCCCCTTTCCCTGGTAGTA
GTAGTAGTATGTTTTCTTATGTGACTCGATATCTTGTTGTTCTGTTCTGTTCTGTTCTTATGCTGTTAATTGTGCAATTGATACATGCTGTTTGAGGGAG
TAAATTCGAAGTCGGATACTTGTATTTCATGATTATTGACAAGAAATGAAATTGAAAAAGAGGAATATAATGGCCCTCCATGCNTATGAACTTAACTAGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.42971.1.S1_at:160:77ATCCAAGTCCATAAAACCTCCAACT16077137Antisense
Mtr.42971.1.S1_at:500:537GCAGCGAGGCTGTGCTTCGACAATT500537220Antisense
Mtr.42971.1.S1_at:291:201ACGCTTGGAGCGTGCTGTGAAGCTT291201293Antisense
Mtr.42971.1.S1_at:1102:957TGAAGCTTGGTTTGAACCCTCCGGA1102957310Antisense
Mtr.42971.1.S1_at:9:119AGGAAATCGCGGAACTCTTGAAGAG9119334Antisense
Mtr.42971.1.S1_at:523:309AAGAATCACTTTGGGACACTCGCAT523309373Antisense
Mtr.42971.1.S1_at:187:611GACACTCGCATTTAGAACGCTGCTT187611387Antisense
Mtr.42971.1.S1_at:406:761GTAGCTTCTTCTGACTTGTTTGTTT406761430Antisense
Mtr.42971.1.S1_at:250:593GAAAATCACTTTCTTGCTGTGTCCC250593473Antisense
Mtr.42971.1.S1_at:542:757GTATGTTTTCTTATGTGACTCGATA542757519Antisense
Mtr.42971.1.S1_at:257:799GTGACTCGATATCTTGTTGTTCTGT257799533Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC94227 /FEA=mRNA /DEF=
Representative public ID: TC94227
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
TC94227
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|AC235662_11.1 DNA polymerase delta subunit 4 (AHRD V1 *-** Q9HCU8); contains Interpro domain(s) IPR007218 DNA polymerase delta, subunit 4 AC235662.8 40758-39915 E EGN_Mt100125 20100825
Medicago v4.0 annotation
Transcript IDDescription
Medtr4g094465.1 DNA polymerase delta subunit 4
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max Gma.17077.1.S1_at Glyma05g25400.1 2e-28 122
Lotus japonicus chr4.CM0337.2_at Link chr4.CM0337.20.nd 3e-25 111
GO annotations
Go TermGo NameEvidence
Search Link GO:0003887 DNA-directed DNA polymerase activity Ji He (2008): BLAST against GO reference database. UNIPROTKB|Q9HCU8 (- symbol:DPOD4_HUMAN "POLD4, POLDS: DNA polymerase subunit delta-4" species:9606 "Homo sapiens" [GO:0003887 "DNA-directed DNA polymerase activity" evidence=TAS] [GO:0005515 "protein binding" evidence=IPI] [GO:0006260 "DNA replication" evidence=TAS] [GO:0005634 "nucleus" evidence=TAS] UniProtKB:Q9HCU8), evalue 1e-009, bit score 62
Search Link GO:0003891 (Possibly obsolete GO name as of Apr 2009) Deborah Samac (2009): BLAST TC123952 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G09815.1, e-value 2.00E-25.
Search Link GO:0005515 protein binding Ji He (2008): BLAST against GO reference database. UNIPROTKB|Q9HCU8 (- symbol:DPOD4_HUMAN "POLD4, POLDS: DNA polymerase subunit delta-4" species:9606 "Homo sapiens" [GO:0003887 "DNA-directed DNA polymerase activity" evidence=TAS] [GO:0005515 "protein binding" evidence=IPI] [GO:0006260 "DNA replication" evidence=TAS] [GO:0005634 "nucleus" evidence=TAS] UniProtKB:Q9HCU8), evalue 1e-009, bit score 62
Search Link GO:0005634 nucleus Ji He (2008): BLAST against GO reference database. UNIPROTKB|Q9HCU8 (- symbol:DPOD4_HUMAN "POLD4, POLDS: DNA polymerase subunit delta-4" species:9606 "Homo sapiens" [GO:0003887 "DNA-directed DNA polymerase activity" evidence=TAS] [GO:0005515 "protein binding" evidence=IPI] [GO:0006260 "DNA replication" evidence=TAS] [GO:0005634 "nucleus" evidence=TAS] UniProtKB:Q9HCU8), evalue 1e-009, bit score 62
Search Link GO:0006260 DNA replication Ji He (2008): BLAST against GO reference database. UNIPROTKB|Q9HCU8 (- symbol:DPOD4_HUMAN "POLD4, POLDS: DNA polymerase subunit delta-4" species:9606 "Homo sapiens" [GO:0003887 "DNA-directed DNA polymerase activity" evidence=TAS] [GO:0005515 "protein binding" evidence=IPI] [GO:0006260 "DNA replication" evidence=TAS] [GO:0005634 "nucleus" evidence=TAS] UniProtKB:Q9HCU8), evalue 1e-009, bit score 62
Deborah Samac (2009): BLAST TC123952 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G09815.1, e-value 2.00E-25.
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
1.4.1.20.6 Search POLD DNA polymerase delta complex KEGG: Homolog to ath:At1g09815 (2e-24): F21M12.40; DNA polymerase delta subunit 4 family [EC:2.7.7.7] [KO:K03505]
2.4.1.4.4 Search POLD4 DNA polymerase delta, subunit D KEGG: Homolog to ath:At1g09815 (2e-24): F21M12.40; DNA polymerase delta subunit 4 family [EC:2.7.7.7] [KO:K03505]
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC