Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.8113.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.8113.1.S1_at
CGCTGTTATTATAATCGAGCGTCGTCGATGTGGTGGGTGATTTCGACTATCACGCCCTACGGCGATAAGTATACGGCGCGTCAGCCACTCTGTCCTCGTC
GCGGTCCGGCGCCTCCATACTCTATACACTCAGTACACTCATTAGTCTCTACTCATCTGCTGTGCGGGCGCTCACTGACGGGTGGTGCGAGATTATAACA
CTGTCATCGGCGCTGTAATACTGGGTGTGCGGATCCTCACATTTTGCTGCTCTACGTCTATACCTATCATGCTGCTGATATGCTCTCGCTCTCGTCGCGC
GGGGCGTTTGGGTGGCGCGGGCGGTGGTGACTACGGGCATCGTGGCGCTACTCGATCACTCTCTATTACAACCGCACACGGAATCACGGCTGTACTCTCA
GCCTCCTTACCACGCTTCGACCGGGCGTGGGGGGTTTGGGGGGGCGCCCAAAAAACCATGGGGCGGTAAACACATGGGGGAAAATATCGAAAACCAGGGT
TGGTTTGTCTCCTCGGCGTTGTGGGTAAATGGGATGTATACATTCCCCACTTCCGCGCATACCCCGGGGGAATTCGTTTGATGTGCCGATTTATTAGGGT
CCTTGTTCGGGGGGGGGTCCCAATAGGGTTTCCTACTTCTTTTTGCGTTTCCCGGGGGGGGGGCCGGGACGGGGACGGCGCGCCATCTCCGTGGGGTTGG
GCACCCACAAGTGGGAAAGAGCGCGGGGGAAATTGTTGGTTCAGGGACTCGGGTGATAATACTCTACTGTTTCGTCTGTTCGGCTCCTGGTAGGGTATGG
TTAAATGGCTTGCCCCTTGTTTCGCTGGGTTGCCGGCGTCAAAAACTTCATCCTCCCTTTCCGGCCGGCATCTCTTCCCTCTCTTGCCGCTCCCGGGTTT
TTGAGTGGGTGGCGGGGCTCTTCGGGATGGGATTTTGGGGTCTCCTTTAACTTTGTTTGTTTTGCCCTCGTGCTT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.8113.1.S1_at:307:207ACGGAATCACGGCTGTACTCTCAGC307207390Antisense
Mtr.8113.1.S1_at:5:929TGTCTCCTCGGCGTTGTGGGTAAAT5929518Antisense
Mtr.8113.1.S1_at:811:921TGGGATGTATACATTCCCCACTTCC811921542Antisense
Mtr.8113.1.S1_at:727:819GGGAATTCGTTTGATGTGCCGATTT727819580Antisense
Mtr.8113.1.S1_at:833:927TGTGCCGATTTATTAGGGTCCTTGT833927594Antisense
Mtr.8113.1.S1_at:338:821GGGACTCGGGTGATAATACTCTACT338821756Antisense
Mtr.8113.1.S1_at:691:355AATACTCTACTGTTTCGTCTGTTCG691355770Antisense
Mtr.8113.1.S1_at:658:443CGTCTGTTCGGCTCCTGGTAGGGTA658443785Antisense
Mtr.8113.1.S1_at:1161:87ATGGTTAAATGGCTTGCCCCTTGTT116187809Antisense
Mtr.8113.1.S1_at:97:727GTTGCCGGCGTCAAAAACTTCATCC97727841Antisense
Mtr.8113.1.S1_at:776:217ACTTTGTTTGTTTTGCCCTCGTGCT776217962Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
BQ144264 /FEA=mRNA /DEF=
Representative public ID: BQ144264
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
BQ144264
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
No information available.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC