Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.42756.1.S1_at Predicted as a legume specific gene  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.42756.1.S1_at
GCTACAACCTTACCCTCGGTTGGCTTAAAAAGGCCTAGGGAATGCGAAACGTTTTTTCGGTTACCTAGAATCAGGCTGAATAGCTACTTAGCAGTGATAG
ATGGGTCTATTGGTTTCATCTCTAATATTGAGGTGTTAAGTTTTTATGACATATGGATTTTGGGTGAAGTCGGTGTTAAAGAATCGTGGATTAAACTTTT
TGTTGTTGATGCCCCTTGCAAAATGCGTCCTTTTGGGATAGGCATCAAGAGCTTTATATTTTTCATAAAAGGTGATGAGGAGATAGCTTGGTATGATTTA
AGTACCCAAAGGATTGAGGAGATCAAGGTCAAAGGAGAGTCAGCTGGGTTGCAAATTATTGTTTATAAGGAAAACCTTCTTTTTTTTGAAGGAATTAATA
TTTAATGTATTGGTAGTTTAATTTATATTTACTTTTACCCTGCATTGATTTTATAAATAAACCAAAATATGGGCTT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.42756.1.S1_at:1147:1097TTTTCGGTTACCTAGAATCAGGCTG1147109766Antisense
Mtr.42756.1.S1_at:5:1015TCAGGCTGAATAGCTACTTAGCAGT5101583Antisense
Mtr.42756.1.S1_at:64:701GATAGATGGGTCTATTGGTTTCATC64701108Antisense
Mtr.42756.1.S1_at:254:783GTCGGTGTTAAAGAATCGTGGATTA254783181Antisense
Mtr.42756.1.S1_at:319:939TGTTGATGCCCCTTGCAAAATGCGT319939216Antisense
Mtr.42756.1.S1_at:200:273AAAATGCGTCCTTTTGGGATAGGCA200273232Antisense
Mtr.42756.1.S1_at:673:1157TTGGGATAGGCATCAAGAGCTTTAT6731157245Antisense
Mtr.42756.1.S1_at:924:693GATCAAGGTCAAAGGAGAGTCAGCT924693333Antisense
Mtr.42756.1.S1_at:204:657GAGTCAGCTGGGTTGCAAATTATTG204657349Antisense
Mtr.42756.1.S1_at:823:1107TTATATTTACTTTTACCCTGCATTG8231107435Antisense
Mtr.42756.1.S1_at:530:1115TTACTTTTACCCTGCATTGATTTTA5301115441Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC112332 /FEA=mRNA /DEF=
Representative public ID: TC112332
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
TC112332
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
ILLUM|contig_72054_1 F-box protein (Fragment) (AHRD V1 *--- B0Z665_9ROSA)
Medicago v4.0 annotation
Transcript IDDescription
Medtr8g033090.1 F-box protein interaction domain protein
Legume specific gene
Based on BLAST searches, this transcript is predicted as legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Lotus japonicus Ljwgs_016758.1_at Link LjSGA_016758.1 0.00000006 40
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC