Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.48133.1.S1_at Involves in at least one biological pathways  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.48133.1.S1_at
ATGTGCTTCGATAACGTGAAGGGAAAGATAGAAATCACTGTTATTGTTGAACTATGTCGGAGAATAATGTTTCATACTACAAAACTTACAATCCAAGCAA
AGACATTGAAATTAAAATCTGAAATGACAAAGTGGATGAAACAGCAGCTAGTTATTTCAGGAGGTGGTTGGTGCAATGACTTGAAATCATGCTTGGAGAG
AGCAAAAACTCGCAGGGGTTCAACAAATTACATGACCAAATATGAGACCTTCAATGGTATTTTAAGCAACAATGCTACCGTTAATCCAGACTTTTACAAT
TGGAACAGGGTGAAGCTGAGATACTGTGATGGAGCTTCATTTACTGGAAACAGAGTGTTCAATAATGGGACAACAAAGCTTTACTTCAAAGGGCAAAATA
TTTGGGAAGCCATTATTGCCGACATTCTGCCAAAAGGTTTAGGAAAGGCACGCAAGGCTTTGCTTTCAGGCTGCTCAGCAGGAGGTTTGGCCACCTTTCA
CCATTGTGACAATTTCACCAAGTATTTGCCAACCAATGCTAGTGTTAAATGCTTGAGTGATGCAGGTTTTTTCCTTGATGGAAGAGATGTCAGTTTGAAC
CACACCATGAGATACTTTTTCAAAAGTGTAGTTACGTTGCAGGGGTCAGTACAGAACCTGAATAAAAACTGCACCAGTGCAATGTCTTCTTATCCAGACC
TGGTATGTTTCCATGAACTTTCATCATTAGCTCAGGAAGATTGTACAAGATTCTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.48133.1.S1_at:1125:209ACTGCACCAGTGCAATGTCTTCTTA1125209680Antisense
Mtr.48133.1.S1_at:321:443CTGCACCAGTGCAATGTCTTCTTAT321443681Antisense
Mtr.48133.1.S1_at:503:1069TATCCAGACCTGGTATGTTTCCATG5031069703Antisense
Mtr.48133.1.S1_at:144:979TCCAGACCTGGTATGTTTCCATGAA144979705Antisense
Mtr.48133.1.S1_at:908:629GACCTGGTATGTTTCCATGAACTTT908629709Antisense
Mtr.48133.1.S1_at:642:471CCTGGTATGTTTCCATGAACTTTCA642471711Antisense
Mtr.48133.1.S1_at:829:845GGTATGTTTCCATGAACTTTCATCA829845714Antisense
Mtr.48133.1.S1_at:753:957TGAACTTTCATCATTAGCTCAGGAA753957726Antisense
Mtr.48133.1.S1_at:367:285AACTTTCATCATTAGCTCAGGAAGA367285728Antisense
Mtr.48133.1.S1_at:1161:1009TCATTAGCTCAGGAAGATTGTACAA11611009736Antisense
Mtr.48133.1.S1_at:1074:511GCTCAGGAAGATTGTACAAGATTCT1074511742Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
1593.m00037 /FEA=mRNA /DEF=AC131240.14 79301 83672 mth2-33j22 weakly similar to UP|Q9FF93 (Q9FF93) Pectinacetylesterase
Representative public ID: 1593.m00037
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
No information available.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
Go TermGo NameEvidence
Search Link GO:0004091 carboxylesterase activity Deborah Samac (2009): BLAST TC117284 (evalue 0) against TAIR Arabidopsis genes. Top hit AT5G23870.1, e-value 2.00E-58.
Search Link GO:0005615 extracellular space Ji He (2008): BLAST against GO reference database. FB|FBgn0044028 (- symbol:Notum "Notum" species:7227 "Drosophila melanogaster" [GO:0030178 "negative regulation of Wnt receptor signaling pathway" evidence=NAS] [GO:0016055 "Wnt receptor signaling pathway" evidence=NAS;IMP] [GO:0005615 "extracellular space" evidence=IDA] [GO:0006029 "proteoglycan metabolic process" evidence=NAS] [GO:0019213 "deacetylase activity" evidence=IDA] [GO:0006507 "GPI anchor release" evidence=IMP] [GO:0048190 "wing disc dorsal/ventral pattern formation" evidence=IGI] [GO:0048076 "regulation of compound eye pigmentation" evidence=IMP] UniProtKB:Q8IQN5), evalue 4e-007, bit score 54
Search Link GO:0006029 proteoglycan metabolic process Ji He (2008): BLAST against GO reference database. FB|FBgn0044028 (- symbol:Notum "Notum" species:7227 "Drosophila melanogaster" [GO:0030178 "negative regulation of Wnt receptor signaling pathway" evidence=NAS] [GO:0016055 "Wnt receptor signaling pathway" evidence=NAS;IMP] [GO:0005615 "extracellular space" evidence=IDA] [GO:0006029 "proteoglycan metabolic process" evidence=NAS] [GO:0019213 "deacetylase activity" evidence=IDA] [GO:0006507 "GPI anchor release" evidence=IMP] [GO:0048190 "wing disc dorsal/ventral pattern formation" evidence=IGI] [GO:0048076 "regulation of compound eye pigmentation" evidence=IMP] UniProtKB:Q8IQN5), evalue 4e-007, bit score 54
Search Link GO:0006507 GPI anchor release Ji He (2008): BLAST against GO reference database. FB|FBgn0044028 (- symbol:Notum "Notum" species:7227 "Drosophila melanogaster" [GO:0030178 "negative regulation of Wnt receptor signaling pathway" evidence=NAS] [GO:0016055 "Wnt receptor signaling pathway" evidence=NAS;IMP] [GO:0005615 "extracellular space" evidence=IDA] [GO:0006029 "proteoglycan metabolic process" evidence=NAS] [GO:0019213 "deacetylase activity" evidence=IDA] [GO:0006507 "GPI anchor release" evidence=IMP] [GO:0048190 "wing disc dorsal/ventral pattern formation" evidence=IGI] [GO:0048076 "regulation of compound eye pigmentation" evidence=IMP] UniProtKB:Q8IQN5), evalue 4e-007, bit score 54
Search Link GO:0008150 biological_process Deborah Samac (2009): BLAST TC117284 (evalue 0) against TAIR Arabidopsis genes. Top hit AT5G23870.1, e-value 2.00E-58.
Search Link GO:0016055 Wnt receptor signaling pathway Ji He (2008): BLAST against GO reference database. FB|FBgn0044028 (- symbol:Notum "Notum" species:7227 "Drosophila melanogaster" [GO:0030178 "negative regulation of Wnt receptor signaling pathway" evidence=NAS] [GO:0016055 "Wnt receptor signaling pathway" evidence=NAS;IMP] [GO:0005615 "extracellular space" evidence=IDA] [GO:0006029 "proteoglycan metabolic process" evidence=NAS] [GO:0019213 "deacetylase activity" evidence=IDA] [GO:0006507 "GPI anchor release" evidence=IMP] [GO:0048190 "wing disc dorsal/ventral pattern formation" evidence=IGI] [GO:0048076 "regulation of compound eye pigmentation" evidence=IMP] UniProtKB:Q8IQN5), evalue 4e-007, bit score 54
Search Link GO:0019213 deacetylase activity Ji He (2008): BLAST against GO reference database. FB|FBgn0044028 (- symbol:Notum "Notum" species:7227 "Drosophila melanogaster" [GO:0030178 "negative regulation of Wnt receptor signaling pathway" evidence=NAS] [GO:0016055 "Wnt receptor signaling pathway" evidence=NAS;IMP] [GO:0005615 "extracellular space" evidence=IDA] [GO:0006029 "proteoglycan metabolic process" evidence=NAS] [GO:0019213 "deacetylase activity" evidence=IDA] [GO:0006507 "GPI anchor release" evidence=IMP] [GO:0048190 "wing disc dorsal/ventral pattern formation" evidence=IGI] [GO:0048076 "regulation of compound eye pigmentation" evidence=IMP] UniProtKB:Q8IQN5), evalue 4e-007, bit score 54
Search Link GO:0030178 negative regulation of Wnt receptor signaling pathway Ji He (2008): BLAST against GO reference database. FB|FBgn0044028 (- symbol:Notum "Notum" species:7227 "Drosophila melanogaster" [GO:0030178 "negative regulation of Wnt receptor signaling pathway" evidence=NAS] [GO:0016055 "Wnt receptor signaling pathway" evidence=NAS;IMP] [GO:0005615 "extracellular space" evidence=IDA] [GO:0006029 "proteoglycan metabolic process" evidence=NAS] [GO:0019213 "deacetylase activity" evidence=IDA] [GO:0006507 "GPI anchor release" evidence=IMP] [GO:0048190 "wing disc dorsal/ventral pattern formation" evidence=IGI] [GO:0048076 "regulation of compound eye pigmentation" evidence=IMP] UniProtKB:Q8IQN5), evalue 4e-007, bit score 54
Search Link GO:0048076 regulation of compound eye pigmentation Ji He (2008): BLAST against GO reference database. FB|FBgn0044028 (- symbol:Notum "Notum" species:7227 "Drosophila melanogaster" [GO:0030178 "negative regulation of Wnt receptor signaling pathway" evidence=NAS] [GO:0016055 "Wnt receptor signaling pathway" evidence=NAS;IMP] [GO:0005615 "extracellular space" evidence=IDA] [GO:0006029 "proteoglycan metabolic process" evidence=NAS] [GO:0019213 "deacetylase activity" evidence=IDA] [GO:0006507 "GPI anchor release" evidence=IMP] [GO:0048190 "wing disc dorsal/ventral pattern formation" evidence=IGI] [GO:0048076 "regulation of compound eye pigmentation" evidence=IMP] UniProtKB:Q8IQN5), evalue 4e-007, bit score 54
Search Link GO:0048190 wing disc dorsal/ventral pattern formation Ji He (2008): BLAST against GO reference database. FB|FBgn0044028 (- symbol:Notum "Notum" species:7227 "Drosophila melanogaster" [GO:0030178 "negative regulation of Wnt receptor signaling pathway" evidence=NAS] [GO:0016055 "Wnt receptor signaling pathway" evidence=NAS;IMP] [GO:0005615 "extracellular space" evidence=IDA] [GO:0006029 "proteoglycan metabolic process" evidence=NAS] [GO:0019213 "deacetylase activity" evidence=IDA] [GO:0006507 "GPI anchor release" evidence=IMP] [GO:0048190 "wing disc dorsal/ventral pattern formation" evidence=IGI] [GO:0048076 "regulation of compound eye pigmentation" evidence=IMP] UniProtKB:Q8IQN5), evalue 4e-007, bit score 54
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.1.4.4741 Search GO_ID:50700 Gene Ontology: Homolog to GO_ID:50700 (2e-53): TAIR|gene:2041428 SPTR:O80731 symbol:AT2G46930.1 [GO:0016789 "carboxylic ester hydrolase activity" evidence=ISS] InterPro:IPR002016 Pfam:PF03283 PROSITE:PS00435 EMBL:AC004411 EMBL:AY052671 PIR:T02194 InterPro:IPR004963 SPTR:O80731
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC