Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.20947.1.S1_at Involves in at least one biological pathways  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.20947.1.S1_at
ATGTATGACGGCGTCGAAGATTTTCTTAGTAGTGACAATAGCATCATCCCTATAAGGTACTCTTACAGAGATATAAAAAAGATAACCGAACAATTCAAGA
CAAAACTAGGCAATGGAGGGTATGGATCTGTTTTCAAAGGACAACTTCGAAGTGGTCGTCTTGTAGCAGTCAAATTATTGGACAAAGCCAAGTCCAGTGA
TCAAGATTTTGTCAATGAAGTTGCTACCATTGGTAGGATTCACCATGTTAATGTGGTGCAGCTCATTGGTTTTTGTGTGGAAGGTTCAAAACGTGTTCTT
ATATATGAATTCATGCCAAATGGATCACTTGAAAAATACATATTTTCTCATACAAAAGAGAATTATTCCTTAAGTTGCGAACAATTGTATTCAATTTCTC
TTGGAGTGGCTCGTGGCATTGAGTACTTGCATCATGGATGCAATATGAAAATTCTACACTTTGATATAAAGCCTCATAACATTCTTCTTGATGAAAATTT
CAATCCAAAAGTTTCTGATTTTGGACTAGCTAGACTTTGTCCTACAGATAAAAGCATTGTGTCATTAACTGCAGCAAGAGGAACCATTGGATATATGGCC
CCTGAACTATTCTACAGAAATGTTGGCACAATATCTTACAAAGCTGATGTATATAGTTTTGGGATGTTGTTGATGGAGATGGCAAGTAGAAGGAAGAACT
TGAATGCATTGGCTGAGCAATCCAGCCAAATTTATTTTCCTTTTTGGATTTATGATAAATTTCATGATGGAAGTGAAGTAACAATTGAGAACGACACAGA
TCAGGAAATGAAGCTAGCAAAGAAAATGATGATTGTGGCGTTATGGTGTATACAGACAAAACCTGATGATCGTCCTTCAATGGATAAAGTTTTGGAGATG
CTTGAAGAAGAAGATGGAGACTTGCAGATTCCTAATAAGCCTTACTTTTGTCCACAAGATTCACCAATAGCGGATGTTTACAGTAGCAACTCATGGACTT
CCGATGGTACATCAGTTAGTGGTTCCAAGGGACCAAACTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.20947.1.S1_at:1057:367AATTGAGAACGACACAGATCAGGAA1057367795Antisense
Mtr.20947.1.S1_at:1025:421CTTACTTTTGTCCACAAGATTCACC1025421953Antisense
Mtr.20947.1.S1_at:262:219ACTTTTGTCCACAAGATTCACCAAT262219956Antisense
Mtr.20947.1.S1_at:132:929TGTCCACAAGATTCACCAATAGCGG132929961Antisense
Mtr.20947.1.S1_at:61:481CCACAAGATTCACCAATAGCGGATG61481964Antisense
Mtr.20947.1.S1_at:719:375CAAGATTCACCAATAGCGGATGTTT719375967Antisense
Mtr.20947.1.S1_at:1156:709GATTCACCAATAGCGGATGTTTACA1156709970Antisense
Mtr.20947.1.S1_at:469:1017TCACCAATAGCGGATGTTTACAGTA4691017973Antisense
Mtr.20947.1.S1_at:859:355AATAGCGGATGTTTACAGTAGCAAC859355978Antisense
Mtr.20947.1.S1_at:1011:501GCGGATGTTTACAGTAGCAACTCAT1011501982Antisense
Mtr.20947.1.S1_at:597:863GGATGTTTACAGTAGCAACTCATGG597863984Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|1134.m00019 /FEA=mRNA /DEF=Protein kinase; Serine/threonine protein kinase, active site; Tyrosine protein kinase; Protein kinase-like AC146775.8.191 65207 64167 mth2-95g14 01/13/05
Representative public ID: IMGAG|1134.m00019
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr1g031530.1 Kinase R-like protein (Fragment) (AHRD V1 *-*- Q8W1F1_AEGTA); contains Interpro domain(s) IPR002290 Serine/threonine protein kinase chr01_pseudomolecule_IMGAG_V3.5 9269207-9259764 E EGN_Mt100125 20100825
Medicago v4.0 annotation
Transcript IDDescription
Medtr1g031530.1 receptor-like kinase
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max Gma.16705.1.S1_at Glyma13g09740.1 4e-16 79.5
Glycine max GmaAffx.84794.1.S1_at Glyma10g41820.1 0.000000000005 65.9
Glycine max Gma.8125.1.S1_at Glyma20g25310.1 0.00000000001 64.5
Glycine max GmaAffx.90491.1.A1_s_at Glyma09g31370.1; Glyma09g31430.1 0.0000000002 60.9
Glycine max GmaAffx.90491.1.S1_at Glyma09g31370.1; Glyma09g31430.1 0.0000000002 60.9
Lotus japonicus TM0068.45_at Link LjT06N06.390.nd 3e-24 95.8
Lotus japonicus TM0068.15_at Link LjT06N06.180.nd 0.000000000000001 78.1
Lotus japonicus Ljwgs_068392.1_at Link LjSGA_068392.1 0.00000000000005 72.7
Lotus japonicus Ljwgs_013318.1_at Link LjSGA_013318.1 0.00000000000009 71.8
Lotus japonicus chr4.CM0073.98.2_at Link chr4.CM0042.920.nc 0.0000000000006 69.1
GO annotations
Go TermGo NameEvidence
Search Link GO:0005524 ATP binding Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-035, bit score 148
Search Link GO:0005576 extracellular region Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-035, bit score 148
Search Link GO:0005886 plasma membrane Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-035, bit score 148
Search Link GO:0006468 protein amino acid phosphorylation Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-035, bit score 148
Deborah Samac (2009): BLAST TC139036 (evalue 0) against TAIR Arabidopsis genes. Top hit AT5G39030.1, e-value 6.00E-93.
Search Link GO:0016301 kinase activity Deborah Samac (2009): BLAST TC139036 (evalue 0) against TAIR Arabidopsis genes. Top hit AT5G39030.1, e-value 6.00E-93.
Search Link GO:0019199 transmembrane receptor protein kinase activity Ji He (2008): BLAST against GO reference database. UNIPROTKB|P93194 (- symbol:RPK1_IPONI "INRPK1: Receptor-like protein kinase precursor" species:35883 "Ipomoea nil" [GO:0005524 "ATP binding" evidence=NAS] [GO:0005576 "extracellular region" evidence=NAS] [GO:0005886 "plasma membrane" evidence=NAS] [GO:0006468 "protein amino acid phosphorylation" evidence=NAS] [GO:0019199 "transmembrane receptor protein kinase activity" evidence=NAS] UniProtKB:P93194), evalue 3e-035, bit score 148
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
1.1.17.19 Search E2.7.1.- [EC:2.7.1.-] [COG:COG0515 COG1493] COG: Homolog to YJL095w (8e-18): COG0515
1.11.16.8 Search E2.7.1.- [EC:2.7.1.-] [COG:COG0515 COG1493] COG: Homolog to YJL095w (8e-18): COG0515
1.7.8.19 Search WAAY, rfaY lipopolysaccharide core biosynthesis protein RFAY [EC:2.7.-.-] [COG:COG0515] COG: Homolog to YJL095w (8e-18): COG0515
1.9.4.15 Search E2.7.1.- [EC:2.7.1.-] [COG:COG0515 COG1493] COG: Homolog to YJL095w (8e-18): COG0515
3.2.2.1 Search Protein kinase [EC:2.7.1.37] Swiss-Prot: Homolog to SRK6_BRAOE (8e-52): ATP-binding; Glycoprotein; Kinase; Membrane; Nucleotide-binding; Receptor; Self-incompatibility; Serine/threonine-proteinkinase; Signal; Transferase; Transmembrane,Putative serine/threonine-protein kinase receptor precursor (EC 2.7.1.37) (S-receptor kinase) (SRK).
3.3.10.117 Search BMPR1 bone morphogenetic protein receptor, type I [EC:2.7.1.37] Swiss-Prot: Homolog to SRK6_BRAOE (8e-52): ATP-binding; Glycoprotein; Kinase; Membrane; Nucleotide-binding; Receptor; Self-incompatibility; Serine/threonine-proteinkinase; Signal; Transferase; Transmembrane,Putative serine/threonine-protein kinase receptor precursor (EC 2.7.1.37) (S-receptor kinase) (SRK).
4.2.4 Search Cell cycle [CLASS:04110] [PATH:hsa04110] [COG:COG0515] COG: Homolog to YJL095w (8e-18): COG0515
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC