Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.33257.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.33257.1.S1_at
GCACGAGGTTCAAATCAAAATCATAAACTATATGCAATTTGTCAGAAATATATTCTTTGGATAATTCAATTCCCTCAGAGATTGATTTGGAAAAATTCTA
TCTTTTCTAGTACATTAGAATAAGCTGGTATTGGCTCATGCCTAATTTCAAGTGGAGGATATAAATGATCTGATCTAGAAAGGGTATATAAATACATGGC
TGTCCTCAGATTATAGTGGTATTTCTTGATTTTGGTTTTAAATATTTGAGGATATGGAGATGATACATCAAGAAAAATCTGAAATCAATGGTATCAGCGG
TATACCAGGTCCACAGGAAAGGTTAGACAATCTGATGCGTCAAGCAGGGAACAAGTTCTGTGCTGATTGTGGATCATCAGAGCCAAAATGGGTGTCTTCA
AGTCTTGGAGTATTTATTTGCATCAAGTGCTCTGGTATACACAGAAGCCTAGGAGTCCATATATCTAAGGTTCTGTCACTGAATCTTGATGATTGGACAG
ACGAACAAGTTGATTCATTGGTCAACTTGGGTGGAAATACACTAATCAATAAGAAGTACCAAGCTTGCGTGCCAAGTTACGT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.33257.1.S1_at:999:409CATAAACTATATGCAATTTGTCAGA99940934Antisense
Mtr.33257.1.S1_at:368:285AACTATATGCAATTTGTCAGAAATA36828538Antisense
Mtr.33257.1.S1_at:200:775GTCAGAAATATATTCTTTGGATAAT20077553Antisense
Mtr.33257.1.S1_at:870:393CAGCGGTATACCAGGTCCACAGGAA870393307Antisense
Mtr.33257.1.S1_at:701:183AGCGGTATACCAGGTCCACAGGAAA701183308Antisense
Mtr.33257.1.S1_at:473:451CGGTATACCAGGTCCACAGGAAAGG473451310Antisense
Mtr.33257.1.S1_at:698:49ATAAGAAGTACCAAGCTTGCGTGCC69849561Antisense
Mtr.33257.1.S1_at:60:309AAGAAGTACCAAGCTTGCGTGCCAA60309563Antisense
Mtr.33257.1.S1_at:648:569GAAGTACCAAGCTTGCGTGCCAAGT648569565Antisense
Mtr.33257.1.S1_at:45:139AGTACCAAGCTTGCGTGCCAAGTTA45139567Antisense
Mtr.33257.1.S1_at:787:189ACCAAGCTTGCGTGCCAAGTTACGT787189570Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
BF648079 /FEA=mRNA /DEF=weakly similar to UP|Q91VZ6 (Q91VZ6) Stromal membrane-associated protein 1, partial (12%)
Representative public ID: BF648079
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
BF648079 weakly similar to UP|Q91VZ6 (Q91VZ6) Stromal membrane-associated protein 1, partial (12%)
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
Transcript IDDescription
Medtr3g017500.2 calcium-dependent ARF-type GTPase activating family protein
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max Gma.1315.2.S1_at Glyma09g02830.1; Glyma15g13700.1 2e-31 132
Glycine max GmaAffx.82538.1.S1_at Glyma03g32910.1 2e-17 85.8
Glycine max GmaAffx.33003.1.S1_at Glyma06g39690.1; Glyma12g22360.1; Glyma12g22360.2 0.000000000000003 78.5
Glycine max GmaAffx.93235.1.S1_s_at Glyma11g32270.1; Glyma12g34840.1; Glyma13g35740.1 0.00000001 57
Lotus japonicus chr1.TM1612.5_at Link chr1.LjT14I13.20.nd 1e-19 93.2
Lotus japonicus Ljwgs_127022.1_at Link LjSGA_127022.1 2e-19 92.7
Lotus japonicus Ljwgs_041040.0.1_at Link LjSGA_041040.0.1 7e-19 90.9
Lotus japonicus chr4.CM0175.16_at Link chr4.CM0175.90.nd 2e-18 89.5
Lotus japonicus Ljwgs_041040.0.1_s_at Link LjSGA_041040.0.1 0.000000000000005 78
GO annotations
Go TermGo NameEvidence
Search Link GO:0003674 molecular_function Ji He (2008): BLAST against GO reference database. MGI|MGI:2138261 (- symbol:Smap1 "stromal membrane-associated protein 1" species:10090 "Mus musculus" [GO:0003674 "molecular_function" evidence=ND] [GO:0045648 "positive regulation of erythrocyte differentiation" evidence=IDA] [GO:0005575 "cellular_component" evidence=ND] UniProtKB:Q91VZ6), evalue 2e-021, bit score 100
Deborah Samac (2009): BLAST BF648079 (evalue 0) against TAIR Arabidopsis genes. Top hit AT3G07940.1, e-value 5.00E-35.
Search Link GO:0005575 cellular_component Ji He (2008): BLAST against GO reference database. MGI|MGI:2138261 (- symbol:Smap1 "stromal membrane-associated protein 1" species:10090 "Mus musculus" [GO:0003674 "molecular_function" evidence=ND] [GO:0045648 "positive regulation of erythrocyte differentiation" evidence=IDA] [GO:0005575 "cellular_component" evidence=ND] UniProtKB:Q91VZ6), evalue 2e-021, bit score 100
Search Link GO:0043087 regulation of GTPase activity Deborah Samac (2009): BLAST BF648079 (evalue 0) against TAIR Arabidopsis genes. Top hit AT3G07940.1, e-value 5.00E-35.
Search Link GO:0045648 positive regulation of erythrocyte differentiation Ji He (2008): BLAST against GO reference database. MGI|MGI:2138261 (- symbol:Smap1 "stromal membrane-associated protein 1" species:10090 "Mus musculus" [GO:0003674 "molecular_function" evidence=ND] [GO:0045648 "positive regulation of erythrocyte differentiation" evidence=IDA] [GO:0005575 "cellular_component" evidence=ND] UniProtKB:Q91VZ6), evalue 2e-021, bit score 100
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.1.3.2.247 Search AGE2_YEAST Swiss-Prot: Homolog to AGE2_YEAST (4e-19): Completeproteome; Golgistack; GTPaseactivation; Metal-binding; Zinc; Zinc-finger,Protein AGE2.||Gene Ontology: Homolog to GO_ID:33573 (3e-35): TAIR|gene:2077366 SPTR:Q8L7A4 symbol:AT3G07940.1 [GO:0005554 "molecular function unknown" evidence=ND] [GO:0008372 "cellular component unknown" evidence=ND] Pfam:PF01412 InterPro:IPR001164 InterPro:IPR000008 PRINTS:PR00405 SMART:SM00105 PROSITE:PS50115 Pfam:PF00168 SMART:SM00239 PROSITE:PS50004 PRINTS:PR00360 HSSP:P04410 EMBL:AY136381 EMBL:BT002109 SPTR:Q8L7A4
99.1.4.5703 Search GO_ID:33573 Swiss-Prot: Homolog to AGE2_YEAST (4e-19): Completeproteome; Golgistack; GTPaseactivation; Metal-binding; Zinc; Zinc-finger,Protein AGE2.||Gene Ontology: Homolog to GO_ID:33573 (3e-35): TAIR|gene:2077366 SPTR:Q8L7A4 symbol:AT3G07940.1 [GO:0005554 "molecular function unknown" evidence=ND] [GO:0008372 "cellular component unknown" evidence=ND] Pfam:PF01412 InterPro:IPR001164 InterPro:IPR000008 PRINTS:PR00405 SMART:SM00105 PROSITE:PS50115 Pfam:PF00168 SMART:SM00239 PROSITE:PS50004 PRINTS:PR00360 HSSP:P04410 EMBL:AY136381 EMBL:BT002109 SPTR:Q8L7A4
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC