Medicago truncatula Gene Expression Atlas
      Mt Gene Expression Atlas | Noble Foundation | Plant Biology 
 
     
Transcript Details

Mtr.25045.1.S1_s_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.25045.1.S1_s_at
ATGTCTCTTCAGAAGCAACCATCGCATGTGCGTCCAGAAATCTGGCACACATGTGCTACCGCTGCCGTCAAAATTCCAAAGTTGCATTCAAGGGTTTATT
ATTTCCCACAAGGTCACCTAGAAAACGCTTCTCCTTCTTCTTCCTCCATTACTCACACACACTCTTTTCTACAAAGTTTTCGTCCTTTCACTCTTTGTAT
TGTCTCCGCTGTTGATCTCCTTGCCGATCCTCACACGGATGAGGTCTTTGTTAAACTTCTACTTACTCCAATAACCAACGATGTCCATCTTGAAAACCCT
AAAGAAGAGGTTGCCAATCTCAACGACCGCAATGAAGTTGTTTCCTTTGTCAAGACTCTCACTCGTTCTGATGTTAACAACGCTCGGTCATTCCACATAC
CTCGCTTTTGTGCCGATAATGTCTTCCCGCAGCTTGACCTAGAGGCCGAATCCTCGTCTCAACACCTGTTCGTTACCGACGTTCATGGTGAAGTTTCAAA
GTTTTACCATGTCTGCCGCGGGTTTCCCAAGAGAAACATGTTATATATCTCTGAATGGAATTCGTTTGTTAAGAGGAAGAAACTCGTAGCCGGAGATTCT
GTTATTTTCATGAAAGACTCAACGGGAAAGATATTCGTTGGAATTCGCAGGAACACGCAGTTTGTTGCAGCGGCTGCAGAGCAGAAGAAGGATGAGTTGG
AGAAGGCAGTAATGGAGGCATTGAAGTTGGCGGAAGAGAACAAGGCATTTGAAATTGTTTACTATCCCCAAGGTGATGATTGGTGTGATTTTGTAGTGGA
TGGTAATGTTGTTGATGAATCAATGAAGATTCAATGGAACCCTAGAATGAGAGTTAAGATGAAGACTGATAAATCTTCAAGGATCCCATATCAAGGGACA
ATCTCTATTGTATCTCGTACTTCTAATTTATGGCGCATGCTTCAGGTTAATTGGGATGAATTTCAAGTCTCGCAAATTCCAAGACGTGTCAACCCGTGGT
GGGTTGAGCTTATTTCTCACAAACCTGCTCCGACGCCATTCCCCCAAACAAAAAAATTTAGAACTACTCAAAGTTCTGCCCAACTAAGTGATAAAAAGGA
AACATTATTGAATGGTGATGGTTTTCCTGTTGATATACAGCGAGTGAGGCATGATCTTGTTTCCATATCAGGTCCTATACATAGCCATATTATTTTGAAC
TCCTCTGAAACAAAGTTTCCTGCGACTCACAATTGCAACACCAAAAATGACAGTGATGGTTCAATTATGTTATTTGGTAAGATCATACAGCCTCATGTAA
GCAATTTTCACAATTCTCATATCAAGGGAGATGATGGCTATAAGAGCTGTGGATTTGGTGTAAAGAACTAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.25045.1.S1_s_at:1010:285AACTACTCAAAGTTCTGCCCAACTA10102851074Antisense
Mtr.25045.1.S1_s_at:964:319AAGTTCTGCCCAACTAAGTGATAAA9643191083Antisense
Mtr.25045.1.S1_s_at:546:849GGTTTTCCTGTTGATATACAGCGAG5468491132Antisense
Mtr.25045.1.S1_s_at:1041:47ATACAGCGAGTGAGGCATGATCTTG1041471147Antisense
Mtr.25045.1.S1_s_at:594:659GAGTGAGGCATGATCTTGTTTCCAT5946591154Antisense
Mtr.25045.1.S1_s_at:835:689GATCTTGTTTCCATATCAGGTCCTA8356891165Antisense
Mtr.25045.1.S1_s_at:976:57ATCAGGTCCTATACATAGCCATATT976571179Antisense
Mtr.25045.1.S1_s_at:113:485GCCATATTATTTTGAACTCCTCTGA1134851196Antisense
Mtr.25045.1.S1_s_at:427:321AAGTTTCCTGCGACTCACAATTGCA4273211225Antisense
Mtr.25045.1.S1_s_at:1123:495GCGACTCACAATTGCAACACCAAAA11234951234Antisense
Mtr.25045.1.S1_s_at:443:1151TTGGTAAGATCATACAGCCTCATGT44311511286Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
1787.m00062 /FEA=mRNA /DEF=AY515252.1 125751 128148 mth2-50E03
Representative public ID: 1787.m00062
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
AY515252_43.4 Transcriptional factor B3
AC134322_48.5 Transcriptional factor B3
AC134322_52.5 Transcriptional factor B3
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr2g006270.1 Auxin response factor 3 (AHRD V1 **** A4L9W4_GOSHI); contains Interpro domain(s) IPR003340 Transcriptional factor B3 chr02_pseudomolecule_IMGAG_V3.5 513034-510637 H EGN_Mt100125 20100825
IMGA|Medtr2g006400.1
IMGA|Medtr2g006540.1
Medicago v4.0 annotation
Transcript IDDescription
Medtr2g006270.1 auxin response factor
Medtr2g006380.1 auxin response factor
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
Go TermGo NameEvidence
Search Link GO:0003700 transcription factor activity Deborah Samac (2009): BLAST NP7273872 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G77850.1, e-value 6.00E-60.
Search Link GO:0009653 anatomical structure morphogenesis Deborah Samac (2009): BLAST NP7273872 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G77850.1, e-value 6.00E-60.
Search Link GO:0009734 auxin mediated signaling pathway Deborah Samac (2009): BLAST NP7273872 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G77850.1, e-value 6.00E-60.
Search Link GO:0045449 regulation of transcription Deborah Samac (2009): BLAST NP7273872 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G77850.1, e-value 6.00E-60.
Search Link GO:0048830 adventitious root development Deborah Samac (2009): BLAST NP7273872 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G77850.1, e-value 6.00E-60.
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.1.3.2.2470 Search ARFQ_ARATH Swiss-Prot: Homolog to ARFQ_ARATH (1e-67): Auxinsignalingpathway; DNA-binding; Multigenefamily; Nuclearprotein; Transcription; Transcriptionregulation,Auxin response factor 17.||Gene Ontology: Homolog to GO_ID:47699 (9e-63): TAIR|gene:2057516 SPTR:Q9SKN5 symbol:ARF10 "AUXIN RESPONSE FACTOR 10" [GO:0003700 "transcription factor activity" evidence=ISS] [GO:0006355 "regulation of transcription, DNA-dependent" evidence=ISS] [GO:0007389 "pattern specification" evidence=IDA] [GO:0051301 "cell division" evidence=IGI] [GO:0035198 "miRNA binding" evidence=ISS] InterPro:IPR003340 InterPro:IPR010525 Pfam:PF02362 PROSITE:PS50863 PROSITE:PS50962 EMBL:AC006283 EMBL:AF099735 EMBL:AF325073 EMBL:AF336919 PIR:G84683 TRANSFAC:T04533 GeneFarm:3383 Pfam:PF06507 SPTR:Q9SKN5
99.1.4.63 Search GO_ID:47699 Swiss-Prot: Homolog to ARFQ_ARATH (1e-67): Auxinsignalingpathway; DNA-binding; Multigenefamily; Nuclearprotein; Transcription; Transcriptionregulation,Auxin response factor 17.||Gene Ontology: Homolog to GO_ID:47699 (9e-63): TAIR|gene:2057516 SPTR:Q9SKN5 symbol:ARF10 "AUXIN RESPONSE FACTOR 10" [GO:0003700 "transcription factor activity" evidence=ISS] [GO:0006355 "regulation of transcription, DNA-dependent" evidence=ISS] [GO:0007389 "pattern specification" evidence=IDA] [GO:0051301 "cell division" evidence=IGI] [GO:0035198 "miRNA binding" evidence=ISS] InterPro:IPR003340 InterPro:IPR010525 Pfam:PF02362 PROSITE:PS50863 PROSITE:PS50962 EMBL:AC006283 EMBL:AF099735 EMBL:AF325073 EMBL:AF336919 PIR:G84683 TRANSFAC:T04533 GeneFarm:3383 Pfam:PF06507 SPTR:Q9SKN5
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© 2014 by The Samuel Roberts Noble Foundation, Inc.