Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.48532.1.S1_at Predicted as a legume specific gene  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.48532.1.S1_at
ATGGCAAAACACATTTCCCAGTACTTTCTCTTGGGAATTTTATTCATTGCATTGGTTCTAACTTCAGGATCAACACCAGGTTTGTTTTTCTGCAGTTCTC
CTTCGTTTTGTGATAGCCCTCCTAATTGCGACGCAAGGTGTCGCACAGCGGGGTATCAAAGTGGAGTATGTACTGACATTCCGGGAAATTCTTGTTGCTG
TGTGTAA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.48532.1.S1_at:498:1123TTCAGGATCAACACCAGGTTTGTTT498112375Antisense
Mtr.48532.1.S1_at:133:279AACACCAGGTTTGTTTTTCTGCAGT13327984Antisense
Mtr.48532.1.S1_at:221:125AGGTTTGTTTTTCTGCAGTTCTCCT22112590Antisense
Mtr.48532.1.S1_at:837:1153TTGTTTTTCTGCAGTTCTCCTTCGT837115394Antisense
Mtr.48532.1.S1_at:301:965TGCAGTTCTCCTTCGTTTTGTGATA301965103Antisense
Mtr.48532.1.S1_at:34:145AGTTCTCCTTCGTTTTGTGATAGCC34145106Antisense
Mtr.48532.1.S1_at:818:417CTTCGTTTTGTGATAGCCCTCCTAA818417113Antisense
Mtr.48532.1.S1_at:749:1085TTTGTGATAGCCCTCCTAATTGCGA7491085119Antisense
Mtr.48532.1.S1_at:162:43ATAGCCCTCCTAATTGCGACGCAAG16243125Antisense
Mtr.48532.1.S1_at:1085:1141TTGCGACGCAAGGTGTCGCACAGCG10851141138Antisense
Mtr.48532.1.S1_at:651:753GTATCAAAGTGGAGTATGTACTGAC651753165Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|1169.m00003 /FEA=mRNA /DEF=Somatomedin B AC147407.10.31 9820 10129 mth2-159b14 01/13/05
Representative public ID: IMGAG|1169.m00003
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
TC107691
AC147407_3.5 hypothetical protein
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
Transcript IDDescription
Medtr3g049730.1 LCR related
Legume specific gene
Based on BLAST searches, this transcript is predicted as legume specific.
Homolog transcripts
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC