Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Sme.5778.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Sme.5778.1.S1_at
ATGACACTCGCAAGGGCTCCGCAGCGCAAGATACCGGCTACCGTCATCACCGGCTTTCTCGGTGCCGGCAAGACGACGATGATCCGCAACCTGCTGCAGA
ATGCCGACGGCAAGCGCATAGCGCTGATCATCAACGAATTCGGCGATCTCGGGGTCGACGGCGATGTGCTGAAGGGCTGCGGAGCGGAAGCCTGTTCGGA
AGAGGATATCATCGAACTGACCAATGGCTGCATCTGCTGCACCGTTGCCGACGACTTCATCCCGACCATGACGAAGCTGCTCGAGAGGGAGAACCGGCCG
GATCATATCGTCATCGAAACCTCCGGCCTGGCGCTGCCGCAGCCGCTCGTCGCCGCATTCAACTGGCCGGACATCCGCAGCGAGGTAACGGTCGACGGCG
TCGTCACAGTGGTCGATAGCGCAGCGGTCGCCGCGGGCCGCTTTGCGGATGATCACGACAAGGTGGACGCGCTGCGCGTCGGCGACGATAATCTCGACCA
CGAGAGCCCGCTCGAAGAACTTTTCGAGGATCAGCTCACCGCCGCAGACCTCATCGTTCTCAACAAGACGGACCTTATCGACGCCGCGGGACTCAAGTCC
GTGCGCGAAGAGGTGGCCTCCCGCATCAGCCGCAAGCCGACGATGATCGAGGCGAGGAACGGCGAGGTAGCCGCCGCCATCCTGCTCGGGCTTGGCGTGG
GTACGGAGGGCGATATCGTCAACCGCAAGTCTCACCACGAGATGGAACATGAGGCAGGCGAGGAGCATGATCACGACGAGTTCGACAGCTTCGTCGTAGA
GCTCGGCGCGATAGCCGACCCTGCCGCTTTCACCGAAAGGCTCAAGGGCGTGATTTCAGAGCACGACGTGCTGCGCCTCAAGGGCTTCGTCGACGTTCCG
GGAAAGCCGATGCGCCTCCTGGTCCAGGCGGTCGGCAGCCGCATCGACCAGTATTTCGACCGCGCATGGGCTTCCGGCCAAACACGCAGCACGCGTCTCG
TCGTCATCGGGCTGCACGACATGGACGAGCCTGCCGTGCGTGCAGCGATTTCGGCACTCGTGTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Sme.5778.1.S1_at:218:677GATGATCCGCAACCTGCTGCAGAAT21867790Antisense
Sme.5778.1.S1_at:755:185AGCGCATAGCGCTGATCATCAACGA755185125Antisense
Sme.5778.1.S1_at:137:59ATCATCGAACTGACCAATGGCTGCA13759220Antisense
Sme.5778.1.S1_at:627:449CGGCCGGATCATATCGTCATCGAAA627449307Antisense
Sme.5778.1.S1_at:1025:621GACGGCGTCGTCACAGTGGTCGATA1025621406Antisense
Sme.5778.1.S1_at:263:647GAGAGCCCGCTCGAAGAACTTTTCG263647514Antisense
Sme.5778.1.S1_at:737:587GAACTTTTCGAGGATCAGCTCACCG737587529Antisense
Sme.5778.1.S1_at:201:161AGACCTCATCGTTCTCAACAAGACG201161558Antisense
Sme.5778.1.S1_at:158:661GAGGGCGATATCGTCAACCGCAAGT158661718Antisense
Sme.5778.1.S1_at:261:693GATCACGACGAGTTCGACAGCTTCG261693781Antisense
Sme.5778.1.S1_at:31:1013TCATCGGGCTGCACGACATGGACGA3110131016Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
TIGR|NT01SM2691 /FEA=mRNA /DEF=PROBABLE COBALAMINE BIOSYNTHESIS PROTEIN {Sinorhizobium meliloti 1021}
Representative public ID: TIGR|NT01SM2691
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
No information available.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
Go TermGo NameEvidence
Search Link GO:0003674 molecular_function Ji He (2008): BLAST against GO reference database. TIGR_CMR|SPO_2862 (- symbol:SPO_2862 "cobW protein" species:246200 "Silicibacter pomeroyi DSS-3" [GO:0003674 "molecular_function" evidence=ND] [GO:0009236 "cobalamin biosynthetic process" evidence=ISS] UniProtKB:Q5LPI6), evalue 6e-083, bit score 306
Search Link GO:0009236 cobalamin biosynthetic process Ji He (2008): BLAST against GO reference database. TIGR_CMR|SPO_2862 (- symbol:SPO_2862 "cobW protein" species:246200 "Silicibacter pomeroyi DSS-3" [GO:0003674 "molecular_function" evidence=ND] [GO:0009236 "cobalamin biosynthetic process" evidence=ISS] UniProtKB:Q5LPI6), evalue 6e-083, bit score 306
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC