Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.40547.1.S1_at Predicted as a transcription factor  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.40547.1.S1_at
ATTATGGCCGGGGAACTAAGGACAGTGTGTGAAACAGACTAATCAATAAGGTTTCTTCATAGAGAAGGAGAAAAGAAATTGATATAGACACCCCCCTTAT
AAAAGATAGAAAGTTGCAAAGAGGATCATATCTGAAGAAAAAGACTGGACCCTCTTTCTGTCACAGCCTACAACTTTAGATTATATTAGATATTATTACT
TTGACAACAATAAGCTTTGATCTTTCTTTGCTTCTCTTTATACAATTCTAATTATTGATCATTCTTATAAGGATATGAGAATGGTCTAAAGAATATTTAT
GCATGGCGAGCCAAAGAATAGGAGAACTTGATTTTTCTGAGACAGGACATTCAACTCATCATGTCCCTTATGGAATTCATCATAGGATTAATAATAATAA
TCCTTCATCAAGCTTAATGAATGAAGAATCTGGTTTTGATTTTGGGGAGCTAGAAGAAGCAATTGTTTTGCAAGGAGTTAAGAATGGAAATGATGAAACA
AAAGCATCTTTTTTCACAGCCAGACCTGCTGCTACACTGGAAATGTTCCCTTCTTGGCCAATGAGATTCCATCAAACCTCAACAGTAGGAGGTGGTAACA
AATCAGGAGGTGAAAGCAGTGATTCAGCACTATCAAGCAAAAATGAGAACCCTTTTGAGCCAGAATCACCCTTAAGTAGTAAAAAAGCATCTTCTTTTTC
ATCAGATCATAATAATAATATGGATCAGCAGAATCTTCAGCTACAACAACAGAAGATGATAATATCCAATGATGCTTCTGCTGCTATAAGAACAGCCTCT
TCATCACAGAATCAAATATCAGCAGCAGCCAAAGAAAAGAAAAAAGGAGCTGGTTCAACATCAGATAAGCCACTTGATGCAAAGACATTGAGACGTTTAG
CACAAAACAGGGAGGCTGCAAGGAAAAGTCGTCTAAGGAAAAAGGCTTATGTGCAACAACTTGAGTCAAGTAGATTAAAGCTTACACAATTGGAACAAGA
CCTTCAAAGAGCACGCTCTCAGGGTATGTTCATGGATTGGAGTGGTGGTGTTGGAGGCAATATAAGCTCTGGAGGTGCAATGTTTGACATGGAATATGGA
AGATGGTTAGAAGAAGACAACCGTTTATTAACGGAGTTAAGAAACGGATTGCAAGCGGCGTTAACAGATAATGAAATGAGAGTAATGGTGGATGGATATT
TGTGTCATTATGATCAAATATTTAGACTCAAAGGTGTCACTGCTAAATCAGACGTGTTTCATCTTATCAATGGCATGTGGACTTCTCAAGCTGAACGTTG
CTTCCTTTGGATTGGTGGTTTTAGACCTTCTGAAATTATCATGATGTTGATCCAACAATTGGAGCCACTAGCTGAGCAGCAGATAATGGGGATGTATGGA
CTGAGGCATTCTTCTCAGCAAGCAGAGGAAGCTCTCTCACAAGGACTTGACCAGTTGCAACAGTCTCTTGTTGACACCATTGCTGGAGGACCCCTTGTTG
ATGGTGTTCAACAAATGGTTGTTGCTATAGGCAAGCTTTCCAATCTTGAAGGTTTTCTTCGCCAGGCCGATAACTTGAGGCAACAAACTCTTCACCAATT
ATGTCGATTACTCACACTTCGTCAAGCAGTACGCTCTTTTCTTGTTATTGGAGAATATTATGGACGACTTCGAGCTCTTAGTTCTCTTTGGGCATCAAGA
CCACGAGAGAACATGATCAGTGATGATAACTCATGCCAAACAACAACAGACATGCAAATGGTTCAACCTTCTCAGAATCATTTCACAAATTTCTGATAGA
TGTATAATTAAAGTCCTACAAGTGGTTCTTGTTTGGCTGCTTAATTTAGAAAATGTCAGTTGTTATCTAGGAAAAATTATTTATTTATTTTACTTTTCAA
TCATCTGTTCTGGTGCCTTTATGTTTATTGTACATGTAAATTGAGCTTTATGTGCATGATGAGGAAGCTCCAATCCAACTTTAGCTAAAGAGAAATAGAA
AAACAGTTTATGAAAATTGAAAAGGTGCCTGCGAGATATAGTTAAAGTATCC

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.40547.1.S1_at:1094:279AACAGTCTCTTGTTGACACCATTGC10942791471Antisense
Mtr.40547.1.S1_at:785:1143TTGACACCATTGCTGGAGGACCCCT78511431483Antisense
Mtr.40547.1.S1_at:320:665GAGGACCCCTTGTTGATGGTGTTCA3206651498Antisense
Mtr.40547.1.S1_at:943:967TGCTATAGGCAAGCTTTCCAATCTT9439671535Antisense
Mtr.40547.1.S1_at:543:565GAAGGTTTTCTTCGCCAGGCCGATA5435651560Antisense
Mtr.40547.1.S1_at:828:709GATTACTCACACTTCGTCAAGCAGT8287091618Antisense
Mtr.40547.1.S1_at:724:175AGCAGTACGCTCTTTTCTTGTTATT7241751637Antisense
Mtr.40547.1.S1_at:109:107ATGGACGACTTCGAGCTCTTAGTTC1091071672Antisense
Mtr.40547.1.S1_at:631:511GCTCTTAGTTCTCTTTGGGCATCAA6315111686Antisense
Mtr.40547.1.S1_at:810:371CAATCATCTGTTCTGGTGCCTTTAT8103711910Antisense
Mtr.40547.1.S1_at:654:947TGAGGAAGCTCCAATCCAACTTTAG6549471972Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC107523 /FEA=mRNA /DEF=similar to UP|Q93XM6 (Q93XM6) BZIP transcription factor, partial (73%)
Representative public ID: TC107523
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
TC107523 similar to UP|Q93XM6 (Q93XM6) BZIP transcription factor, partial (73%)
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr2g086420.1 BZIP transcription factor (AHRD V1 ***- Q93XM6_ARATH); contains Interpro domain(s) IPR011616 bZIP transcription factor, bZIP-1 chr02_pseudomolecule_IMGAG_V3.5 26542359-26549134 E EGN_Mt100125 20100825
Medicago v4.0 annotation
Transcript IDDescription
Medtr2g086420.1 BZIP family transcription factor
Medtr2g086420.2 BZIP family transcription factor
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max GmaAffx.79390.1.S1_at Glyma12g30990.1; Glyma13g39330.1 2e-46 181
Glycine max Gma.6642.1.A1_at Glyma12g09430.1; Glyma12g09430.2; Glyma12g09430.3 1e-35 137
Glycine max Gma.3727.1.S1_at Glyma13g26280.1; Glyma15g37220.1 8e-22 100
Glycine max GmaAffx.79401.1.S1_at 3e-16 81.7
Glycine max Gma.7757.1.S1_at Glyma03g28320.1; Glyma03g28320.2; Glyma19g31050.1; Glyma19g31050.2; Glyma19g31050.3; Glyma19g31050.4 0.000000000000002 79
Lotus japonicus chr1.CM0009.11.1_at Link chr1.CM0009.80.nd 2e-16 82.6
Lotus japonicus chr3.CM0690.15_at Link chr3.CM0690.180.nc 5e-16 81.3
Lotus japonicus chr4.CM0234.47_at Link chr4.CM0234.370.nd 0.00000000009 63.8
Lotus japonicus TM1262.25_at Link LjT15A14.110.nd 0.0000000006 61.1
Lotus japonicus Ljwgs_031732.1_at Link LjSGA_031732.1 0.000000006 57.9
GO annotations
Go TermGo NameEvidence
Search Link GO:0003677 DNA binding Deborah Samac (2009): BLAST TC121785 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G08320.3, e-value 1.00E-116.
Search Link GO:0005515 protein binding Ji He (2008): BLAST against GO reference database. UNIPROTKB|Q9SQK1 (- symbol:Q9SQK1_TOBAC "TGA2.2: BZIP transcription factor" species:4097 "Nicotiana tabacum" [GO:0005515 "protein binding" evidence=IPI] UniProtKB:Q9SQK1), evalue 5e-065, bit score 248
Search Link GO:0006355 regulation of transcription, DNA-dependent Deborah Samac (2009): BLAST TC121785 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G08320.3, e-value 1.00E-116.
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.1.3.2.2511 Search TGA21_TOBAC Swiss-Prot: Homolog to TGA21_TOBAC (5e-86): Activator; Coiledcoil; DNA-binding; Nuclearprotein; Transcription; Transcriptionregulation,TGACG-sequence-specific DNA-binding protein TGA-2.1 (TGA2.1).||Gene Ontology: Homolog to GO_ID:19122 (6e-128): TAIR|gene:3435149 SPTR:Q93XM6 symbol:AT1G08320.1 [GO:0003700 "transcription factor activity" evidence=ISS] [GO:0003677 "DNA binding" evidence=ISS] InterPro:IPR004827 Pfam:PF00170 GO:GO:0005634 SMART:SM00338 PROSITE:PS50217 PROSITE:PS00036 InterPro:IPR011616 EMBL:AJ314757 SPTR:Q93XM6
99.1.4.3501 Search GO_ID:19122 Swiss-Prot: Homolog to TGA21_TOBAC (5e-86): Activator; Coiledcoil; DNA-binding; Nuclearprotein; Transcription; Transcriptionregulation,TGACG-sequence-specific DNA-binding protein TGA-2.1 (TGA2.1).||Gene Ontology: Homolog to GO_ID:19122 (6e-128): TAIR|gene:3435149 SPTR:Q93XM6 symbol:AT1G08320.1 [GO:0003700 "transcription factor activity" evidence=ISS] [GO:0003677 "DNA binding" evidence=ISS] InterPro:IPR004827 Pfam:PF00170 GO:GO:0005634 SMART:SM00338 PROSITE:PS50217 PROSITE:PS00036 InterPro:IPR011616 EMBL:AJ314757 SPTR:Q93XM6
Transcription factor prediction and categorization
Family: bZIP Search
Evidence
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC