Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.5457.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.5457.1.S1_at
AACAAAGCCCCCAGAGACAGAGAGAGAAAAAGAAGCGTTAATCTTTGCTTCCTATTACTCTCTCTGATTCGATCCTCTCTTCTGTTTCTTCTCGTTAATC
TCTCTCTTTTTTTGTTGTATATTTCTGTATTCTACACACACATATGACGAGAATTCATCGGAATCGTGATCGCACCGGTAATTCTAACGGCAGCAATGTC
TTTAATTTGCTTGCACGGAGAGAGATTTCACCAAGAACAAAACATGTAGCAAGAGATGCAAAGCGTGTCCTATTGTCATGGGTTGAGGCCGATTCACTGC
GGCATTTATCAGCCAAGTATTGTCCTTTACTACCTGCGCCAAGGTCTACTATTGCAGCGGCGTTTAGTCCAGATGGAAAAGTTCTTGCATCCACACATGG
TGACCACACAGTGAAGATAATCGACTGTGAAACTGGACGTTGCTTAAAGGTGTTAATTGGCCATATGAGGACGCCTTTGGGTGGTTAGGGTTCCATCCAT
TGCATCCAAAAATACTTGCTAGTGGGAGCTGGATCAAGAAGTTCGAATTATTGGGATGCTAACACATCGGGAGTGCATA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.5457.1.S1_at:1013:275AACAAAGCCCCCAGAGACAGAGAGA101327513Antisense
Mtr.5457.1.S1_at:260:185AGCGTTAATCTTTGCTTCCTATTAC26018546Antisense
Mtr.5457.1.S1_at:418:1029TAATCTTTGCTTCCTATTACTCTCT418102951Antisense
Mtr.5457.1.S1_at:899:1079TATTACTCTCTCTGATTCGATCCTC899107965Antisense
Mtr.5457.1.S1_at:625:997TCTGATTCGATCCTCTCTTCTGTTT62599775Antisense
Mtr.5457.1.S1_at:699:713GATTCGATCCTCTCTTCTGTTTCTT69971378Antisense
Mtr.5457.1.S1_at:868:1131TTCTGTTTCTTCTCGTTAATCTCTC868113192Antisense
Mtr.5457.1.S1_at:428:753GTATATTTCTGTATTCTACACACAC428753129Antisense
Mtr.5457.1.S1_at:813:751GTATTCTACACACACATATGACGAG813751139Antisense
Mtr.5457.1.S1_at:883:431CTACACACACATATGACGAGAATTC883431144Antisense
Mtr.5457.1.S1_at:1120:307AAGAAGTTCGAATTATTGGGATGCT1120307548Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
BE325600 /FEA=mRNA /DEF=similar to UP|Q6K884 (Q6K884) Transducin-like, partial (13%)
Representative public ID: BE325600
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
BE325600 similar to UP|Q6K884 (Q6K884) Transducin-like, partial (13%)
AC133341_56.5 IPR001680: WD-40 repeat IPR001093: IMP dehydrogenase/GMP reductase IPR011047: Quinonprotein alcohol dehydrogenase-like
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
No information available.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Lotus japonicus Ljwgs_066249.1_at Link LjSGA_066249.1 7e-38 154
GO annotations
Go TermGo NameEvidence
Search Link GO:0000166 nucleotide binding Deborah Samac (2009): BLAST TC120983 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G04140.2, e-value 4.00E-29.
Search Link GO:0005737 cytoplasm Ji He (2008): BLAST against GO reference database. UNIPROTKB|Q9C0C7 (- symbol:AMRA1_HUMAN "AMBRA1, KIAA1736: Activating molecule in BECN1-regulated autophagy protein 1" species:9606 "Homo sapiens" [GO:0005737 "cytoplasm" evidence=IDA] UniProtKB:Q9C0C7), evalue 5e-010, bit score 62
Search Link GO:0008150 biological_process Deborah Samac (2009): BLAST TC120983 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G04140.2, e-value 4.00E-29.
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.1.4.6207 Search GO_ID:24183 Gene Ontology: Homolog to GO_ID:24183 (4e-33): TAIR|gene:2020284 SPTR:Q94C94 symbol:AT1G04140.1 [GO:0000004 "biological process unknown" evidence=ND] [GO:0000166 "nucleotide binding" evidence=ISS] InterPro:IPR001680 Pfam:PF00400 ProDom:PD000018 SMART:SM00320 PROSITE:PS00678 PROSITE:PS50082 PROSITE:PS50294 GO:GO:0005634 EMBL:AY035051 EMBL:AY133865 SPTR:Q94C94
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC