Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.37125.1.S1_at Predicted as a legume specific gene  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.37125.1.S1_at
AATCAATCTCTTTTAAAATACATTAACTTTATATATTGGTACCCAAGATAAAGTAACAACTTCAATTCTGCATTGAAGCAGACGCTCTAGCTTCAAGTTC
ATGAGTTATCAGGTCTAATGTGCTTCTGTAGTTTAACAAATTAGAGTAGAGTGTAAGAAAATCATCAACTGGACCGGGCGGGTCACACTTCTAGTTACTT
GTTTTTTACAAGTGAGTCTCTTAATCAAGCTCTACCTTACGTTGATCATTTTCAAGGTTATGCCACTTCAATTTTTGAAGTTCGGAAGGTCAAGATCAGG
TGTAGCGCATGATATCCATGTATCAAGACCATCATGGCACAAAGCAGTTTTCGGCCACATATATATATTCAATGTCATGTCAAAAATCAATACCACTGAC
CACCTGCTCCGCCTTGAGCAGCCAGCGAACGTTTTCCTTGGCTATGTATGAGGTTTGGCTGAGCCATTTGAACTT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.37125.1.S1_at:996:533GCAGACGCTCTAGCTTCAAGTTCAT99653390Antisense
Mtr.37125.1.S1_at:785:653GAGTTATCAGGTCTAATGTGCTTCT785653115Antisense
Mtr.37125.1.S1_at:978:241AAATCATCAACTGGACCGGGCGGGT978241171Antisense
Mtr.37125.1.S1_at:967:499GCGGGTCACACTTCTAGTTACTTGT967499190Antisense
Mtr.37125.1.S1_at:396:799GTGAGTCTCTTAATCAAGCTCTACC396799224Antisense
Mtr.37125.1.S1_at:52:305AAGCTCTACCTTACGTTGATCATTT52305239Antisense
Mtr.37125.1.S1_at:551:329AAGGTCAAGATCAGGTGTAGCGCAT551329298Antisense
Mtr.37125.1.S1_at:540:541GCACAAAGCAGTTTTCGGCCACATA540541349Antisense
Mtr.37125.1.S1_at:921:273AAAATCAATACCACTGACCACCTGC921273395Antisense
Mtr.37125.1.S1_at:1139:485GCCTTGAGCAGCCAGCGAACGTTTT1139485423Antisense
Mtr.37125.1.S1_at:617:495GCGAACGTTTTCCTTGGCTATGTAT617495437Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC98411 /FEA=mRNA /DEF=
Representative public ID: TC98411
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
TC98411
AC124960_29.4 IPR000719: Protein kinase IPR001093: IMP dehydrogenase/GMP reductase IPR002290: Serine/threonine protein kinase IPR001245: Tyrosine protein kinase IPR003527: MAP kinase IPR011009: Protein kinase-like
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
No information available.
Legume specific gene
Based on BLAST searches, this transcript is predicted as legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max GmaAffx.14535.1.S1_at Glyma15g10940.1; Glyma15g10940.2 0.0000006 26.3
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC