Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.14719.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.14719.1.S1_at
ATGTGGGACATTGGTGGAGATGCATGGGAAAGCTTTGATGGTGTTGGAACTCTTGAAGTTGCATCATTGTCTCTTGATGAACCAAATTTAGAAGCCGTTC
TGTTTACTGATGATGGTGAAGGAGGAGATGACATTGATACCATTCCAATATCTTAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.14719.1.S1_at:794:137AGATGCATGGGAAAGCTTTGATGGT79413730Antisense
Mtr.14719.1.S1_at:527:881GGAACTCTTGAAGTTGCATCATTGT52788158Antisense
Mtr.14719.1.S1_at:591:435CTCTTGAAGTTGCATCATTGTCTCT59143562Antisense
Mtr.14719.1.S1_at:797:959TGAAGTTGCATCATTGTCTCTTGAT79795966Antisense
Mtr.14719.1.S1_at:887:527GCATCATTGTCTCTTGATGAACCAA88752773Antisense
Mtr.14719.1.S1_at:411:781GTCTCTTGATGAACCAAATTTAGAA41178181Antisense
Mtr.14719.1.S1_at:299:357AATTTAGAAGCCGTTCTGTTTACTG29935797Antisense
Mtr.14719.1.S1_at:157:1057TAGAAGCCGTTCTGTTTACTGATGA1571057101Antisense
Mtr.14719.1.S1_at:337:665GAGGAGATGACATTGATACCATTCC337665134Antisense
Mtr.14719.1.S1_at:243:679GATGACATTGATACCATTCCAATAT243679139Antisense
Mtr.14719.1.S1_at:531:415CATTGATACCATTCCAATATCTTAG531415144Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|759.m00022 /FEA=mRNA /DEF=LQGC hypothetical protein AC123899.15.221 105425 105270 mth2-33n6 01/13/05
Representative public ID: IMGAG|759.m00022
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
AC123899_53.4 hypothetical protein
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
Transcript IDDescription
Medtr7g076703.1 hypothetical protein
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC