Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.26606.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.26606.1.S1_at
ATGGATGCAGTCATTGAAATTACCAAATCATTGTTAACTTTTGGGCTTTTAACCATCCGGTTCATAGGGGAAAGGGGCACTGATAATTTGGAGTTTGGTC
AGGAGCTCTCTGGCATCTTAATGATGACACCAGAGCCGTCAAGGGAGTTGGAGAAACTTGAAATCACTGGTCATCATGTTAGGGGGAGTACTGAATATGT
TAGGCTTGCCATATCCGATGAACCGAGGGTCGCTGAAGCTGAAATGCTACAGCCTCAAGCTGAATCAAGAATTACATCTTTCAAGTGGTGGATGAAAGTC
TCTATATGGGGCTTTATCATTGTTATACTTTCACTTCTTCTAGTCAAATGGGGAGTACCCTTTGCTTTTGAAAAGGTTCTTTATCCAGTGATGGAATGGG
AAGCAACTGCCTTTGGCCGACCAGTTCTCGCCCTTGTACTCATTGCTTCACTGGCTTTATTTCCAGTATTATTAATCCCTTCTGGCCCTTCCATGTGGTT
GGCTGGGATGATTTTTGGTTATGGCCTTGGCTTTGTTATAATAATGGTTGGGACAACCATTGGGATGGTCCTCCCTTACCTGATTGGACTTAAGTTCCGT
GACCGTATTCATCAATGGTTAGAGAAATGGCCCCAGAATGCTGCAATGATTAGGCTTGCTGGGGAAGGGAGCTGGTTTCATCAATTTCAAGTGGTTGCTC
TGTTTCGAACTTCACCTTTTCCCTACACTATATTCAATTATGCTGTAGTAGTGACAGATATGAAGTTCTGGCCCTACTTTTGTGGATCAGTAGCAGGAAT
GGTGCCAGAAGCTTTTATCTACATCTACAGTGGTAGATTAATAAAGAGTCTGGCTGATGCACAGTATGGGAGGCACCACATGACCACAGTGGAAATCGTA
TACAACATTATTTCTTTCATCATTGCCGTTATTACCATTGTTGGCTTCACTGTTTACGCAAAAAGGACTCTTAATAAACTCAAAATAGCAGAGGCCAATG
AAGAAGCTGCCTCTGTTTCTGGGAATGCTAGTCTTGAGATGAAGAAGGACTACTTCCTCTCTCCCAATTTTGAACCCTTTGTAATTACCGGAATCAGCAT
ATGTGGGATGGATAGATCATAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.26606.1.S1_at:539:1023TCAATGGTTAGAGAAATGGCCCCAG5391023624Antisense
Mtr.26606.1.S1_at:992:103ATGGTTAGAGAAATGGCCCCAGAAT992103627Antisense
Mtr.26606.1.S1_at:515:849GGTTAGAGAAATGGCCCCAGAATGC515849629Antisense
Mtr.26606.1.S1_at:55:643GAGAAATGGCCCCAGAATGCTGCAA55643634Antisense
Mtr.26606.1.S1_at:218:165AGAAATGGCCCCAGAATGCTGCAAT218165635Antisense
Mtr.26606.1.S1_at:728:603GAAATGGCCCCAGAATGCTGCAATG728603636Antisense
Mtr.26606.1.S1_at:51:249AAATGGCCCCAGAATGCTGCAATGA51249637Antisense
Mtr.26606.1.S1_at:1014:491GCCCCAGAATGCTGCAATGATTAGG1014491642Antisense
Mtr.26606.1.S1_at:650:465CCCAGAATGCTGCAATGATTAGGCT650465644Antisense
Mtr.26606.1.S1_at:1116:395CAGAATGCTGCAATGATTAGGCTTG1116395646Antisense
Mtr.26606.1.S1_at:36:561GAATGCTGCAATGATTAGGCTTGCT36561648Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
1547.m00033 /FEA=mRNA /DEF=AC151000.3 36290 33546 mth2-193p1 weakly similar to TIGR_Ath1|At2g02370-GOpep .1 68409.m00154 expressed protein, partial (89%)
Representative public ID: 1547.m00033
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
AC151000_36.5 F5O11.19, identical
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr2g028450.1 TVP38/TMEM64 family membrane protein slr0305 (AHRD V1 *-*- Q55909); contains Interpro domain(s) IPR015414 SNARE associated Golgi protein chr02_pseudomolecule_IMGAG_V3.5 9440589-9444122 H EGN_Mt100125 20100825
Medicago v4.0 annotation
Transcript IDDescription
Medtr2g028450.1 SNARE associated family protein
Medtr3g064097.1 SNARE associated family protein
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
Go TermGo NameEvidence
Search Link GO:0003674 molecular_function Deborah Samac (2009): BLAST TC118703 (evalue 0) against TAIR Arabidopsis genes. Top hit AT2G02370.1, e-value 5.00E-92.
Search Link GO:0008150 biological_process Deborah Samac (2009): BLAST TC118703 (evalue 0) against TAIR Arabidopsis genes. Top hit AT2G02370.1, e-value 5.00E-92.
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.1.2.212 Search COG0398 Gene Ontology: Homolog to GO_ID:33856 (1e-50): TAIR|gene:2118095 SPTR:Q9SZ65 symbol:AT4G12000.1 [GO:0000004 "biological process unknown" evidence=ND] EMBL:AL161533 EMBL:AL049638 EMBL:AY072165 EMBL:AY096419 PIR:T06607 SPTR:Q9SZ65||Swiss-Prot: Homolog to Y305_SYNY3 (2e-10): Completeproteome; Hypotheticalprotein; Membrane; Transmembrane,Hypothetical UPF0043 protein slr0305.||COG: Homolog to slr0305 (6e-11): COG0398
99.1.3.2.455 Search Y305_SYNY3 Gene Ontology: Homolog to GO_ID:33856 (1e-50): TAIR|gene:2118095 SPTR:Q9SZ65 symbol:AT4G12000.1 [GO:0000004 "biological process unknown" evidence=ND] EMBL:AL161533 EMBL:AL049638 EMBL:AY072165 EMBL:AY096419 PIR:T06607 SPTR:Q9SZ65||Swiss-Prot: Homolog to Y305_SYNY3 (2e-10): Completeproteome; Hypotheticalprotein; Membrane; Transmembrane,Hypothetical UPF0043 protein slr0305.||COG: Homolog to slr0305 (6e-11): COG0398
99.1.4.4802 Search GO_ID:33856 Gene Ontology: Homolog to GO_ID:33856 (1e-50): TAIR|gene:2118095 SPTR:Q9SZ65 symbol:AT4G12000.1 [GO:0000004 "biological process unknown" evidence=ND] EMBL:AL161533 EMBL:AL049638 EMBL:AY072165 EMBL:AY096419 PIR:T06607 SPTR:Q9SZ65||Swiss-Prot: Homolog to Y305_SYNY3 (2e-10): Completeproteome; Hypotheticalprotein; Membrane; Transmembrane,Hypothetical UPF0043 protein slr0305.||COG: Homolog to slr0305 (6e-11): COG0398
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
Family: 9.B.27 (YdjX-Z (YdjX-Z) Family) Search
Evidence
 
         
       
© Noble Research Institute, LLC