Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Sme.5408.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Sme.5408.1.S1_at
ATGAACAAGACGCTGGCCGAGGCAATGGTCTTCGCCGACGGTCTTGCTGCCGCCGACGATGCGCGCGATCAGCGGATACAGCGCTTCGTCATTCCTCCGT
TCACCGCCGCGCGGCAGGTGAAGGAAAGGCTTAAGGCGACGAGCGTCAAGGTCGGTGCGCAGAACATGCACTGGGACGATGCCGGCGCCTGGACCGGCGA
AATTTCCCCGGTCATGCTGAGCGATTGCGATCTCGACATCGTCGAGCTCGGCCACAGCGAGCGGCGGGAGCATTTCGGCGAGACCGACCGCACCGTGGGC
TTGAAGACGGCAGCCGCCGTCAAGCATGGGCTCGTGCCGTTGATCTGCATCGGCGAAACTCTCGCGCAACGCGAAGCGGGCGAGGCGGATACTGTCCTGA
AGCGCCAGGTGGAAGGCGCCTTTGCCTTTCTCGAAGGCGCGGCGCGGAAGGCGCCCGTTCTTCTGGCTTACGAGCCCGTCTGGGCGATCGGCGTCAACGG
CATACCGGCGACCGCCGACTATGCGGACGCCCGCCATCGCCTCATTGGCGAAGTCGCCGAGCGTGCACTCGGCGTGAAGGTTCCGGTGCTCTATGGCGGC
AGCGTCAATCCTCAGAACTGCGAGGAATTGATCCTCCAACCCCATATCGACGGGCTCTTCATCGGCCGCTCCGCCTGGGACGTCGGCGGCTATCTCGACA
TTTTGCAACGCGTAGCCCGGGCGATCTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Sme.5408.1.S1_at:934:665GAGGCAATGGTCTTCGCCGACGGTC93466531Antisense
Sme.5408.1.S1_at:544:625GACGATGCGCGCGATCAGCGGATAC54462567Antisense
Sme.5408.1.S1_at:372:499GCGTCAAGGTCGGTGCGCAGAACAT372499155Antisense
Sme.5408.1.S1_at:215:281AACATGCACTGGGACGATGCCGGCG215281175Antisense
Sme.5408.1.S1_at:436:241AAATTTCCCCGGTCATGCTGAGCGA436241212Antisense
Sme.5408.1.S1_at:387:971TGCTGAGCGATTGCGATCTCGACAT387971227Antisense
Sme.5408.1.S1_at:196:1025TCAAGCATGGGCTCGTGCCGTTGAT1961025332Antisense
Sme.5408.1.S1_at:220:723GTTGATCTGCATCGGCGAAACTCTC220723351Antisense
Sme.5408.1.S1_at:1152:923TGGGCGATCGGCGTCAACGGCATAC1152923493Antisense
Sme.5408.1.S1_at:98:395CAGCGTCAATCCTCAGAACTGCGAG98395612Antisense
Sme.5408.1.S1_at:211:895GGCTATCTCGACATTTTGCAACGCG211895700Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
TIGR|NT01SM3062 /FEA=mRNA /DEF=triosephosphate isomerase (tpiA) {Sinorhizobium meliloti 1021}
Representative public ID: TIGR|NT01SM3062
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
No information available.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
Go TermGo NameEvidence
Search Link GO:0015977 carbon utilization by fixation of carbon dioxide Ji He (2008): BLAST against GO reference database. UNIPROTKB|Q7VC41 (- symbol:TPIS_PROMA "tpiA, tpi, Pro_0901: Triosephosphate isomerase" species:1219 "Prochlorococcus marinus" [GO:0015977 "carbon utilization by fixation of carbon dioxide" evidence=NAS] UniProtKB:Q7VC41), evalue 1e-029, bit score 128
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC