Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.12483.1.S1_at Predicted as a transcription factor  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.12483.1.S1_at
GGCACGAGGTCACTCTCTATCTTTCATCCCTTATATCTCCTCCTCACTCATCACATCTTCAACAATCCTACTCATACTTAAAAAAAAAAAAAAAAAAACT
TATTTCTTTTAGTTCTCCATTTGGCATTTCATTAGCTTTATCAACAAATTTCAAAATCCTTGTTCTTCATGTGCTAGTAGTATAGTGCTTATTTTACTAA
ATAAACCTTTCTTGTGCTATTATAATTATTTTTCAAAAAATGAAAGAGAGCATTAAGTGTGAAGAAATTGGTCTCATTGGTGAACTAATCCAAGGTGAAG
AGCTAGCAAAGAAGCTTTATGACCAAATTTTCTCTCCATCATCACCATCATCATCAACATCATCATCATCATCATCATCAACATCAACTTCATCACATCA
AGTCTTAATTGACAAATTAATTTTGTCCATTGAGACAGCAATAACCATGGCAAAGGGTAATGAGGGAAAAATTAAGACAAACAATGTCAACATGATGGAT
TCTCATTGTTCAAATGGAAGCCCTAAAAGTGAGGTCCAAGACTCAAAGTTCAAGCACAAACATGTGTCTAAGAAAAGAAAAACCGTGCCTAAGTGGACAG
AGCAAGTGAAGGTTTATTCTGGAACAGCAGCTGAAGGGTCTGTGGAGGATGGTCATAGCTGGAGAAAGTATGGACAAAAGGATATTCTTGGAGCTAAGTT
TCCAAGAGGATACTACAGATGCACACATAGACATGCACAAGGTTGTCTAGCTACTAAGCAAGTGCAAAAATCAGATGAAGATGAAATGATATGTGAGATA
ACCTACAAAGGAAGACACACATGTACTCAATCTAACAAGGCACTCCCATCAAAAACAAAGTTGAAATTTGGACAAAATAAATCACAACTCAATCAAAAAA
TTCAACCCCAAGAAGAGAAAATACAATCACCTCTAGAAAATAATTTCTCTATTGACGACAAGGAGGATATATTTCAATCATTCAATTTTTCCTCTCCATC
AATAGGATCTGAAAATGAAGATAACAACATATTTTTAGAGACCATGATTGAAAACAATTTCATGGAAAATGAGGATAACAATATATTCTCAGATTCAAAC
ATTTTCTGCTTGTCATCACTATTGGATTTGGACAGCACTGGACTAGGCCCAAGCGAGAGTAACATCACTG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.12483.1.S1_at:781:593GAAAAACCGTGCCTAAGTGGACAGA781593589Antisense
Mtr.12483.1.S1_at:56:297AACCGTGCCTAAGTGGACAGAGCAA56297593Antisense
Mtr.12483.1.S1_at:959:875GGACAGAGCAAGTGAAGGTTTATTC959875607Antisense
Mtr.12483.1.S1_at:612:123AGGTTTATTCTGGAACAGCAGCTGA612123622Antisense
Mtr.12483.1.S1_at:114:1133TTCTGGAACAGCAGCTGAAGGGTCT1141133629Antisense
Mtr.12483.1.S1_at:49:567GAAGGGTCTGTGGAGGATGGTCATA49567645Antisense
Mtr.12483.1.S1_at:881:119AGGATGGTCATAGCTGGAGAAAGTA881119658Antisense
Mtr.12483.1.S1_at:516:875GGACAAAAGGATATTCTTGGAGCTA516875684Antisense
Mtr.12483.1.S1_at:429:857GGATATTCTTGGAGCTAAGTTTCCA429857692Antisense
Mtr.12483.1.S1_at:1016:869GGAGCTAAGTTTCCAAGAGGATACT1016869702Antisense
Mtr.12483.1.S1_at:1069:1031TAAGTTTCCAAGAGGATACTACAGA10691031707Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC94955 /FEA=mRNA /DEF=similar to UP|WR41_ARATH (Q8H0Y8) Probable WRKY transcription factor 41 (WRKY DNA-binding protein 41), partial (26%)
Representative public ID: TC94955
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
TC94955 similar to UP|WR41_ARATH (Q8H0Y8) Probable WRKY transcription factor 41 (WRKY DNA-binding protein 41), partial (26%)
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|AC233680_9.1 WRKY transcription factor 30 (Fragment) (AHRD V1 *-** B2KJ72_HORVD); contains Interpro domain(s) IPR003657 DNA-binding WRKY AC233680.1 35771-33048 E EGN_Mt100125 20100825
Medicago v4.0 annotation
Transcript IDDescription
Medtr8g027860.1 WRKY family transcription factor
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max GmaAffx.86377.1.S1_at Glyma07g06320.1 2e-18 85.6
Glycine max GmaAffx.51816.1.S1_at Glyma05g36970.1; Glyma05g36980.1; Glyma05g36980.2 0.000000000000002 75.7
Glycine max GmaAffx.12741.1.A1_at Glyma08g26230.1; Glyma18g49830.1 0.00000006 50.8
Glycine max Gma.16679.1.S1_at Glyma19g40470.1 0.0000004 48.1
Glycine max Gma.4400.1.S1_at Glyma19g26400.1 0.0000006 47.6
Lotus japonicus chr1.CM0320.45_at Link chr1.CM0320.400.nd 0.000000008 54
Lotus japonicus Ljwgs_058050.1_at Link LjSGA_058050.1 0.0000003 48.5
Lotus japonicus chr1.TM1635.10_at Link chr1.LjT16J16.70.nd 0.0000004 48.1
Lotus japonicus chr5.CM0239.70_at Link chr5.CM0239.70.nd 0.0000006 47.6
Lotus japonicus chr2.CM0120.8_at Link chr2.CM0120.580.nd 0.0000006 47.6
GO annotations
Go TermGo NameEvidence
Search Link GO:0003677 DNA binding Ji He (2008): BLAST against GO reference database. DICTYBASE|DDB0220001 (- symbol:wrky1 "putative WRKY transcription factor" species:44689 "Dictyostelium discoideum" [GO:0005634 "nucleus" evidence=IC] [GO:0003677 "DNA binding" evidence=ISS] [GO:0008270 "zinc ion binding" evidence=ISS] [GO:0006355 "regulation of transcription, DNA-dependent" evidence=ISS] UniProtKB:Q554C5), evalue 5e-008, bit score 57
Search Link GO:0003700 transcription factor activity Deborah Samac (2009): BLAST TC134696 (evalue 0) against TAIR Arabidopsis genes. Top hit AT4G23810.1, e-value 3.00E-32.
Search Link GO:0005634 nucleus Ji He (2008): BLAST against GO reference database. DICTYBASE|DDB0220001 (- symbol:wrky1 "putative WRKY transcription factor" species:44689 "Dictyostelium discoideum" [GO:0005634 "nucleus" evidence=IC] [GO:0003677 "DNA binding" evidence=ISS] [GO:0008270 "zinc ion binding" evidence=ISS] [GO:0006355 "regulation of transcription, DNA-dependent" evidence=ISS] UniProtKB:Q554C5), evalue 5e-008, bit score 57
Search Link GO:0006355 regulation of transcription, DNA-dependent Ji He (2008): BLAST against GO reference database. DICTYBASE|DDB0220001 (- symbol:wrky1 "putative WRKY transcription factor" species:44689 "Dictyostelium discoideum" [GO:0005634 "nucleus" evidence=IC] [GO:0003677 "DNA binding" evidence=ISS] [GO:0008270 "zinc ion binding" evidence=ISS] [GO:0006355 "regulation of transcription, DNA-dependent" evidence=ISS] UniProtKB:Q554C5), evalue 5e-008, bit score 57
Deborah Samac (2009): BLAST TC134696 (evalue 0) against TAIR Arabidopsis genes. Top hit AT4G23810.1, e-value 3.00E-32.
Search Link GO:0008270 zinc ion binding Ji He (2008): BLAST against GO reference database. DICTYBASE|DDB0220001 (- symbol:wrky1 "putative WRKY transcription factor" species:44689 "Dictyostelium discoideum" [GO:0005634 "nucleus" evidence=IC] [GO:0003677 "DNA binding" evidence=ISS] [GO:0008270 "zinc ion binding" evidence=ISS] [GO:0006355 "regulation of transcription, DNA-dependent" evidence=ISS] UniProtKB:Q554C5), evalue 5e-008, bit score 57
Search Link GO:0031347 regulation of defense response Deborah Samac (2009): BLAST TC134696 (evalue 0) against TAIR Arabidopsis genes. Top hit AT4G23810.1, e-value 3.00E-32.
Search Link GO:0045941 positive regulation of transcription Deborah Samac (2009): BLAST TC134696 (evalue 0) against TAIR Arabidopsis genes. Top hit AT4G23810.1, e-value 3.00E-32.
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.1.3.2.1679 Search WRK30_ARATH Swiss-Prot: Homolog to WRK30_ARATH (5e-29): DNA-binding; Nuclearprotein; Transcription; Transcriptionregulation,Probable WRKY transcription factor 30 (WRKY DNA-binding protein 30).
Transcription factor prediction and categorization
Family: WRKY Search
Evidence
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC