Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.38324.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.38324.1.S1_at
GGGGTCTTTGCCGGTATTCAATTTGAAGAAGCAGTGGAGATATTCAAAGTGATGCATAGGATAGGACAAAAGATTAAAGGTTATGCTTATAAATGTGTCA
TCCTAGGACTGTGTGAGCAAAAGAAGCTTGATAGTGCGATTCAAGCTCTAGACTTGATGGTAAAAGCTCAATGCAAGCCAGATGGGAAAATATATTATAC
TTTACTTAAGTCTGTTGCTAATGAGGGTATGGTAAACGAGGCTAATGATTTGCATCAGAGGTTGATCGAGTTGAAGATTCTAAAAGACGGATGTTTGATA
GTAGGAGCTCACACTTAGATTGGCCAAACTCAATACTTCTTCTGGCCATGTACAAATTATATATTCCTTCCAGGAAAGCTTGTTTGGTTGGGTACTCACC
TATGTATTGCAATGTTCAATAGTATCAGGAATCAGAACTTGGCTCTGGGTAAAATTTTGACTATGGAAGTTGACATACATGTCTTCATTGCTGGTTATTT
GACTATCTGTAATGTCAATTTAATTTCCATATTTGCAGATTCTTAATTAACTCCGGTTTTGTAAGTTGACGTGTGTTGTTCTTATGTTGGTTTTGGTAGT
TCTAAGTTATCTATATATAGTATAATTTGTCCTCTTCTTACGTAACATATTGAGCTTTACACATTTTTGGGCTTAATTGAACTAATCCTTAACTAGAATC
CTTAGCAACGGAAAAAAGTGAGATTTTGTATACAATTTACAGAGGAACCCTAATTCTTAACTAGC

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.38324.1.S1_at:83:871GGAGCTCACACTTAGATTGGCCAAA83871316Antisense
Mtr.38324.1.S1_at:745:263AAACTCAATACTTCTTCTGGCCATG745263338Antisense
Mtr.38324.1.S1_at:190:599GAAAGCTTGTTTGGTTGGGTACTCA190599386Antisense
Mtr.38324.1.S1_at:387:829GGGTACTCACCTATGTATTGCAATG387829402Antisense
Mtr.38324.1.S1_at:1067:753GTATCAGGAATCAGAACTTGGCTCT1067753434Antisense
Mtr.38324.1.S1_at:34:413CTTGGCTCTGGGTAAAATTTTGACT34413450Antisense
Mtr.38324.1.S1_at:443:615GACATACATGTCTTCATTGCTGGTT443615484Antisense
Mtr.38324.1.S1_at:994:9ATTGCTGGTTATTTGACTATCTGTA9949499Antisense
Mtr.38324.1.S1_at:641:963TGCAGATTCTTAATTAACTCCGGTT641963546Antisense
Mtr.38324.1.S1_at:302:753GTATAATTTGTCCTCTTCTTACGTA302753632Antisense
Mtr.38324.1.S1_at:256:1143TTGGGCTTAATTGAACTAATCCTTA2561143679Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
TC102539 /FEA=mRNA /DEF=
Representative public ID: TC102539
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
TC102539
TC102539
AC202369_15.3 IPR002885: Pentatricopeptide repeat IPR001093: IMP dehydrogenase/GMP reductase IPR008940: Protein prenyltransferase
AC146861_27.5 IPR002885: Pentatricopeptide repeat IPR001093: IMP dehydrogenase/GMP reductase IPR008940: Protein prenyltransferase
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr1g080120.1 Pentatricopeptide repeat-containing protein At1g08610 (AHRD V1 ***- Q9FRS4); contains Interpro domain(s) IPR002885 Pentatricopeptide repeat chr01_pseudomolecule_IMGAG_V3.5 20116947-20111965 E EGN_Mt100125 20100825
Medicago v4.0 annotation
Transcript IDDescription
Medtr1g080120.2 PPR containing plant-like protein
Medtr1g080120.1 PPR containing plant-like protein
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
Go TermGo NameEvidence
Search Link GO:0005488 binding Deborah Samac (2009): BLAST TC126728 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G08610.1, e-value 2.00E-09.
Search Link GO:0008150 biological_process Deborah Samac (2009): BLAST TC126728 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G08610.1, e-value 2.00E-09.
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC