Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.14685.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.14685.1.S1_at
ATGTCACAATATACTATGTCCAGTAACAGTTGTGCATCACGAAGAAGAGATGTTCGTTGTTTCTATGATCTTGATTCACCTCTTACTACTGCATGGACAA
CTGAGAATCATGGCCGTAGGTTTAATGGATGTGGGTTATATAAGGCGTGCAAAGGAGGTGATTTTGTCAGTAATGAACTTAAGAAGAAGGATAATATGAA
GTTGAAACAAGATGAAGATTTGAAAAAGAAGCTAAAGTTTTGCAAATGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.14685.1.S1_at:846:97ATGTCACAATATACTATGTCCAGTA8469713Antisense
Mtr.14685.1.S1_at:606:789GTCCAGTAACAGTTGTGCATCACGA60678930Antisense
Mtr.14685.1.S1_at:831:157AGAGATGTTCGTTGTTTCTATGATC83115758Antisense
Mtr.14685.1.S1_at:58:93ATGATCTTGATTCACCTCTTACTAC589377Antisense
Mtr.14685.1.S1_at:65:1019TCACCTCTTACTACTGCATGGACAA65101988Antisense
Mtr.14685.1.S1_at:872:215ACTACTGCATGGACAACTGAGAATC87221597Antisense
Mtr.14685.1.S1_at:36:207ACTGAGAATCATGGCCGTAGGTTTA36207112Antisense
Mtr.14685.1.S1_at:394:351AATCATGGCCGTAGGTTTAATGGAT394351118Antisense
Mtr.14685.1.S1_at:920:669GATGTGGGTTATATAAGGCGTGCAA920669140Antisense
Mtr.14685.1.S1_at:1097:1029TAAGGCGTGCAAAGGAGGTGATTTT10971029153Antisense
Mtr.14685.1.S1_at:511:835GGTGATTTTGTCAGTAATGAACTTA511835169Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|758.m00002 /FEA=mRNA /DEF=LQGC hypothetical protein AC123898.40.21 7175 6787 mth2-31m6 01/13/05
Representative public ID: IMGAG|758.m00002
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
AC123898_43.5 hypothetical protein
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr2g010010.1 Unknown Protein (AHRD V1) chr02_pseudomolecule_IMGAG_V3.5 2300865-2301318 E EGN_Mt100125 20100825
Medicago v4.0 annotation
Transcript IDDescription
Medtr2g010010.1 hypothetical protein
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Lotus japonicus chr1.CM0064.45.1_at Link chr1.CM0064.400.nc 0.00000002 53.3
Lotus japonicus Ljwgs_013688.0.1_at Link LjSGA_013688.0.1 0.000004 46
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC