Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.16398.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.16398.1.S1_at
ATGGCTTTGGGAATAGTCACTAAAAGGTTGGGGAATAAACTTTTTCCAGCATTATCTTCCACTTCCAGGCTTCTACATTCTCATGCCACCAGTTTCGGTT
TCAAACATGTAAACGAAGAAGAAAAGGCACGTATGGTTGGTGATGTATTTACAAGTGTTGCTAAAAACTATGACACCATGAATGATCTAATGAGTGCTGG
GTTGCATAGACTGTGGAAAGAAAGGCTAGTTTCCATGTTGAATCCTTTTCCTGGAATGAAGCATCTTGATGTGGCCGGTGGCACTGGGGATGTTGCTTTT
AGAATCTTGGATAACATAAACAGAGTTAAGCAAAGAGGGCTTCAAGACGGTTTTAACGATGCTCTAGAGGCAAAAACTCAGATATATGTATGTGACATTA
ACCCAAACATGTTGAATGTTGGCAAACAGCGGGCTGCGGAAAAAGGTTATGGAGAAGATGGTTCCCTTGTTTGGGTGGAGGGAAATGCTGAAAGCTTGAG
TTTCCAAGATGATTCGATGGATGGTTACACTATTGCATTTGGGATAAGGAATGTTACACACATCGAGAAAGTTCTAAGTGAAGCTCATAGGGTGTTGAAA
CATGGCGGCAGGTTCCTTTGCCTTGAACTAAGCCATGTTAGTCTCCCTATATTTAAAGAACTGTATGACTTATATTCTTTCTCCGTTATTCCACGCATAG
GAGAGATGGTTGCTGGGGACCGGGAGTCCTATCAGTACTTAGTTGAGAGTATCCGGCGTTTTCCCCCACAGGAAAAATTTGCATCAATGATTGCTGATGC
AGGGTTCCAGAAAGTAGAGTATGAGAATCTAGTTGGGGGAGTGGTAGCCATTCATTCAGGGATAAAAATCTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.16398.1.S1_at:232:205ACGGTTTTAACGATGCTCTAGAGGC232205359Antisense
Mtr.16398.1.S1_at:740:107ATGGAGAAGATGGTTCCCTTGTTTG740107461Antisense
Mtr.16398.1.S1_at:435:917TGGTTACACTATTGCATTTGGGATA435917534Antisense
Mtr.16398.1.S1_at:104:597GAAACATGGCGGCAGGTTCCTTTGC104597609Antisense
Mtr.16398.1.S1_at:109:1139TTCCTTTGCCTTGAACTAAGCCATG1091139625Antisense
Mtr.16398.1.S1_at:925:299AAGCCATGTTAGTCTCCCTATATTT925299642Antisense
Mtr.16398.1.S1_at:103:1107TTATATTCTTTCTCCGTTATTCCAC1031107682Antisense
Mtr.16398.1.S1_at:619:629GACCGGGAGTCCTATCAGTACTTAG619629730Antisense
Mtr.16398.1.S1_at:827:1057TAGTTGAGAGTATCCGGCGTTTTCC8271057752Antisense
Mtr.16398.1.S1_at:166:715GATTGCTGATGCAGGGTTCCAGAAA166715801Antisense
Mtr.16398.1.S1_at:1090:659GAGTGGTAGCCATTCATTCAGGGAT1090659851Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|869.m00002 /FEA=mRNA /DEF=Ubiquinone/menaquinone biosynthesis methyltransferase; UbiE/COQ5 methyltransferase; SAM (and some other nucleotide) binding motif AC135414.31.11 10442 6894 mth2-8n20 01/13/05
Representative public ID: IMGAG|869.m00002
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
Gene IDDescription
TC107503 similar to GB|BAA96953.1|8777363|AB019233 ubiquinone/menaquinone biosynthesis methyltransferase-like {Arabidopsis thaliana;} , partial (89%)
AC148304_19.5 IPR001093: IMP dehydrogenase/GMP reductase IPR004033: UbiE/COQ5 methyltransferase IPR004034: Ubiquinone/menaquinone biosynthesis methyltransferase IPR000051: SAM (and some other nucleotide) binding motif
Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|Medtr3g043800.1 Ubiquinone biosynthesis methyltransferase COQ5, mitochondrial (AHRD V1 ***- Q9LVC8); contains Interpro domain(s) IPR004033 UbiE/COQ5 methyltransferase chr03_pseudomolecule_IMGAG_V3.5 12869489-12873231 E EGN_Mt100125 20100825
IMGA|Medtr4g009880.1
Medicago v4.0 annotation
Transcript IDDescription
Medtr4g009880.1 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
SpeciesProbeset IDTranscript DescriptionE-ValueBit Score
Glycine max GmaAffx.57225.1.S1_at Glyma07g03210.1; Glyma07g03210.2; Glyma08g22890.1 9e-56 213
Glycine max Gma.12739.1.A1_at Glyma08g22890.1 3e-31 131
Lotus japonicus mlr3165_at Link 2e-45 178
Lotus japonicus Ljwgs_032039.1_at Link LjSGA_032039.1 2e-08 56.1
GO annotations
Go TermGo NameEvidence
Search Link GO:0005615 extracellular space Ji He (2008): BLAST against GO reference database. MGI|MGI:1098643 (- symbol:Coq5 "coenzyme Q5 homolog, methyltransferase (yeast)" species:10090 "Mus musculus" [GO:0005615 "extracellular space" evidence=RCA] [GO:0008168 "methyltransferase activity" evidence=RCA] [GO:0008757 "S-adenosylmethionine-dependent methyltransferase activity" evidence=RCA] [GO:0009108 "coenzyme biosynthetic process" evidence=RCA] UniProtKB:Q9CXI0), evalue 1e-055, bit score 215
Search Link GO:0008168 methyltransferase activity Ji He (2008): BLAST against GO reference database. MGI|MGI:1098643 (- symbol:Coq5 "coenzyme Q5 homolog, methyltransferase (yeast)" species:10090 "Mus musculus" [GO:0005615 "extracellular space" evidence=RCA] [GO:0008168 "methyltransferase activity" evidence=RCA] [GO:0008757 "S-adenosylmethionine-dependent methyltransferase activity" evidence=RCA] [GO:0009108 "coenzyme biosynthetic process" evidence=RCA] UniProtKB:Q9CXI0), evalue 1e-055, bit score 215
Deborah Samac (2009): BLAST TC113570 (evalue 0) against TAIR Arabidopsis genes. Top hit AT5G57300.2, e-value 1.00E-106.
Search Link GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Ji He (2008): BLAST against GO reference database. MGI|MGI:1098643 (- symbol:Coq5 "coenzyme Q5 homolog, methyltransferase (yeast)" species:10090 "Mus musculus" [GO:0005615 "extracellular space" evidence=RCA] [GO:0008168 "methyltransferase activity" evidence=RCA] [GO:0008757 "S-adenosylmethionine-dependent methyltransferase activity" evidence=RCA] [GO:0009108 "coenzyme biosynthetic process" evidence=RCA] UniProtKB:Q9CXI0), evalue 1e-055, bit score 215
Search Link GO:0009108 coenzyme biosynthetic process Ji He (2008): BLAST against GO reference database. MGI|MGI:1098643 (- symbol:Coq5 "coenzyme Q5 homolog, methyltransferase (yeast)" species:10090 "Mus musculus" [GO:0005615 "extracellular space" evidence=RCA] [GO:0008168 "methyltransferase activity" evidence=RCA] [GO:0008757 "S-adenosylmethionine-dependent methyltransferase activity" evidence=RCA] [GO:0009108 "coenzyme biosynthetic process" evidence=RCA] UniProtKB:Q9CXI0), evalue 1e-055, bit score 215
Protein domains
Domain IDDomain NameEvidence
IPR004033 UbiE/COQ5 methyltransferase InterProScan of corresponding IMGAG v2 gene AC148304_19.5
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
1.9.11.11 Search COQ5 ubiquinone biosynthesis methyltransferase [EC:2.1.1.-] [COG:COG2226] [GO:0008425] KEGG: Homolog to ath:At5g57300 (4e-120): MJB24.11; UbiE/COQ5 methyltransferase family [EC:2.1.1.-] [KO:K06127]||COG: Homolog to mlr3165 (7e-72): COG2226
1.9.11.6 Search UBIE ubiquinone/menaquinone biosynthesis methyltransferase [EC:2.1.1.-] [COG:COG2226] [GO:0008425] COG: Homolog to mlr3165 (7e-72): COG2226
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC