Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.51307.1.S1_at Predicted as a legume specific gene  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.51307.1.S1_at
ATGCATACCAAACGCAGTAGAACAAGAACTCGCCAGGAAATAAACTTTAGCCGCACTATTTTGAACACATGCTCTATGATTTTTAAAAGTGAATTCGTTT
CCAGTACACTACACCACCAACATGATGATAAACACACGGTTCAAGTCAATCTTCTTGCACCAAGAGAGAAGATCCAGCCCTTAGGTAAACACATACACAT
TATCCAGACCACAAGTTTTCCAAATACTAACAGAATCGACGCAAAAGAACATACAAACATGGTCAAAGTGGTGGTAATTTTAATAATGTTTGAAAATGGT
GGTTCTCGCAAATGTTTGTCGAAGTGGTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.51307.1.S1_at:930:683GATCCAGCCCTTAGGTAAACACATA930683183Antisense
Mtr.51307.1.S1_at:753:277AACACATACACATTATCCAGACCAC753277200Antisense
Mtr.51307.1.S1_at:918:21ATTATCCAGACCACAAGTTTTCCAA91821211Antisense
Mtr.51307.1.S1_at:656:393CAGACCACAAGTTTTCCAAATACTA656393217Antisense
Mtr.51307.1.S1_at:791:479CCAAATACTAACAGAATCGACGCAA791479232Antisense
Mtr.51307.1.S1_at:553:557GAATCGACGCAAAAGAACATACAAA553557245Antisense
Mtr.51307.1.S1_at:535:47ATACAAACATGGTCAAAGTGGTGGT53547263Antisense
Mtr.51307.1.S1_at:470:401CATGGTCAAAGTGGTGGTAATTTTA470401270Antisense
Mtr.51307.1.S1_at:1088:933TGTTTGAAAATGGTGGTTCTCGCAA1088933299Antisense
Mtr.51307.1.S1_at:719:337AATGGTGGTTCTCGCAAATGTTTGT719337307Antisense
Mtr.51307.1.S1_at:368:849GGTTCTCGCAAATGTTTGTCGAAGT368849313Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|835.m00017 /FEA=mRNA /DEF=hypothetical protein AC130809.24.171 69807 70136 mth2-15i12 01/13/05
Representative public ID: IMGAG|835.m00017
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
Gene IDDescription
IMGA|AC229724_1050.1 Unknown Protein (AHRD V1) AC229724.12 197491-197162 I EGN_Mt100125 20100825
IMGA|Medtr1g113990.1
Medicago v4.0 annotation
No information available.
Legume specific gene
Based on BLAST searches, this transcript is predicted as legume specific.
Homolog transcripts
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC