Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Mtr.16033.1.S1_x_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Mtr.16033.1.S1_x_at
ATGGAGGAGAGTCAAGTTAAAAGAGGTAGAGGAAGACCTAGGAAAACTATTAGAGAAACCATTAGAAAGGATTTAGAGGTCAATGAGTTGGATCCAAATT
TGGTGTATGATAGTACACTATGGCGTCAGTTGATCCATGTAGCCGACCCCACTTAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Mtr.16033.1.S1_x_at:203:943TGATAGTACACTATGGCGTCAGTTG203943120Antisense
Mtr.16033.1.S1_x_at:567:699GATAGTACACTATGGCGTCAGTTGA567699121Antisense
Mtr.16033.1.S1_x_at:617:41ATAGTACACTATGGCGTCAGTTGAT61741122Antisense
Mtr.16033.1.S1_x_at:1156:1057TAGTACACTATGGCGTCAGTTGATC11561057123Antisense
Mtr.16033.1.S1_x_at:746:137AGTACACTATGGCGTCAGTTGATCC746137124Antisense
Mtr.16033.1.S1_x_at:914:765GTACACTATGGCGTCAGTTGATCCA914765125Antisense
Mtr.16033.1.S1_x_at:40:1043TACACTATGGCGTCAGTTGATCCAT401043126Antisense
Mtr.16033.1.S1_x_at:1:233ACACTATGGCGTCAGTTGATCCATG1233127Antisense
Mtr.16033.1.S1_x_at:153:389CACTATGGCGTCAGTTGATCCATGT153389128Antisense
Mtr.16033.1.S1_x_at:910:215ACTATGGCGTCAGTTGATCCATGTA910215129Antisense
Mtr.16033.1.S1_x_at:329:1065TATGGCGTCAGTTGATCCATGTAGC3291065131Antisense
Launch Genome Browser View probes mapped to the Mt genome
Initial annotation during chip design
IMGAG|812.m00009 /FEA=mRNA /DEF=HMG-I and HMG-Y, DNA-binding AC126792.14.91 43917 43762 mth2-8o8 01/13/05
Representative public ID: IMGAG|812.m00009
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
No information available.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeNameEvidence
99.2 Search Unclassified without homolog
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC