Noble Research Institute, LLC   Noble Research Institute | Mt Gene Expression Atlas  
      Medicago truncatula Gene Expression Atlas  
 
     
Transcript Details

Sme.2561.1.S1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)




Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Sme.2561.1.S1_at
ATGTTGGCGCAGGGTCGGCGCGAGCGCGAAGGCTTATCGCAGTGTGATGCCCTCCGTCACGGCCAAGCGCGATCAAAAGTCGTTCTCTGGTTCTATCTCG
GCGTGCTCTATACGACGGGGCGTGCAAATGGCTTACGATTGGGATGGAAAGCGAACACGCCGGCTCCAAATGCTGAGGTTCATGGGAGCCCTGGCTGTGC
CTGCTCTGCTATTTGGCTCGGCCCTTGGGGCACTGCAGTGGATCGATACGGACCGTCAGGCCGTAAGGACGGCTCAATTTCGATAGATCTAATGCGAAGC
TGCACCCGTTCAGTTCAGGCTGAAACGCAGAGGCCGAAGGGTCTTCCGTCTCAGCCGGCGGCGGAGGGAGGGGAATGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Sme.2561.1.S1_at:859:113AGGCTTATCGCAGTGTGATGCCCTC85911342Antisense
Sme.2561.1.S1_at:992:453CGTCACGGCCAAGCGCGATCAAAAG99245367Antisense
Sme.2561.1.S1_at:1048:693GATCAAAAGTCGTTCTCTGGTTCTA104869383Antisense
Sme.2561.1.S1_at:595:65ATCTCGGCGTGCTCTATACGACGGG59565107Antisense
Sme.2561.1.S1_at:152:587GAACACGCCGGCTCCAAATGCTGAG152587165Antisense
Sme.2561.1.S1_at:267:247AAATGCTGAGGTTCATGGGAGCCCT267247180Antisense
Sme.2561.1.S1_at:866:889GGCACTGCAGTGGATCGATACGGAC866889241Antisense
Sme.2561.1.S1_at:346:873GGACGGCTCAATTTCGATAGATCTA346873279Antisense
Sme.2561.1.S1_at:926:689GATCTAATGCGAAGCTGCACCCGTT926689298Antisense
Sme.2561.1.S1_at:439:963TGCACCCGTTCAGTTCAGGCTGAAA439963313Antisense
Sme.2561.1.S1_at:750:293AACGCAGAGGCCGAAGGGTCTTCCG750293336Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
TIGR|NT01SMA1322 /FEA=mRNA /DEF=conserved hypothetical protein {Sinorhizobium meliloti 1021}
Representative public ID: TIGR|NT01SMA1322
Gene (re)mapping & annotations
Probe-based mapping to MTGI v8 and IMGAG v2 genes ( Strategy )
No gene mapped to this probeset using this criteria.Mapping to IMGAG V3.5 genes and ILLUMINA contigs ( Strategy )
No gene mapped to this probeset using this criteria.
Medicago v4.0 annotation
No information available.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Homolog transcripts
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC